Incidental Mutation 'R0466:Aspm'
ID41615
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Nameabnormal spindle microtubule assembly
SynonymsAspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 038666-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0466 (G1)
Quality Score188
Status Validated
Chromosome1
Chromosomal Location139454772-139494091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139477901 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1509 (I1509F)
Ref Sequence ENSEMBL: ENSMUSP00000059159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
Predicted Effect probably damaging
Transcript: ENSMUST00000053364
AA Change: I1509F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: I1509F

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199998
Predicted Effect probably benign
Transcript: ENSMUST00000200083
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 intron probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 intron probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
R7427:Aspm UTSW 1 139457616 missense probably benign 0.01
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCATCCAGAGAAGAGTTCGGTGC -3'
(R):5'- GCTAGAACCCTCCTGGCTGAAATG -3'

Sequencing Primer
(F):5'- AGTTCGGTGCTTTCAAGCC -3'
(R):5'- TCCTGGCTGAAATGGAAGCTC -3'
Posted On2013-05-23