Incidental Mutation 'R0466:Dmtf1'
ID41631
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Namecyclin D binding myb-like transcription factor 1
SynonymsDmp1
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location9118801-9161776 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 9132454 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184372] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]
Predicted Effect probably null
Transcript: ENSMUST00000071921
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095017
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183448
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000183973
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184120
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184159
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184401
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184620
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184888
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184947
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9136070 missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9120056 missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9121853 missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9130381 missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9136098 missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9140474 missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9124435 intron probably benign
R0149:Dmtf1 UTSW 5 9132571 missense probably damaging 1.00
R0825:Dmtf1 UTSW 5 9130388 missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0974:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9136109 missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9140383 splice site probably null
R1478:Dmtf1 UTSW 5 9121404 missense possibly damaging 0.93
R1515:Dmtf1 UTSW 5 9140384 critical splice donor site probably null
R1861:Dmtf1 UTSW 5 9120347 splice site probably null
R1898:Dmtf1 UTSW 5 9128091 missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9129323 missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9129316 missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9132454 intron probably benign
R4467:Dmtf1 UTSW 5 9136085 missense probably damaging 1.00
R4490:Dmtf1 UTSW 5 9140379 intron probably benign
R4491:Dmtf1 UTSW 5 9140379 intron probably benign
R5007:Dmtf1 UTSW 5 9122439 unclassified probably benign
R5173:Dmtf1 UTSW 5 9140356 intron probably benign
R5184:Dmtf1 UTSW 5 9126641 missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9124515 missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9122415 unclassified probably benign
R5977:Dmtf1 UTSW 5 9140451 missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9126656 missense probably benign
R6887:Dmtf1 UTSW 5 9137149 missense probably damaging 1.00
R6921:Dmtf1 UTSW 5 9130654 intron probably benign
R7242:Dmtf1 UTSW 5 9149016 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGCGGCTTCATTGTGACCTAAC -3'
(R):5'- AGGCTCGCGGAATAAAAGATGCTAC -3'

Sequencing Primer
(F):5'- AGTACCTGTATGGAGCATCCC -3'
(R):5'- AGATGCTACAGAAATCATCTTTGAG -3'
Posted On2013-05-23