Incidental Mutation 'R0466:Letm1'
ID41632
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Nameleucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33739673-33782817 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 33761730 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
Predicted Effect probably benign
Transcript: ENSMUST00000005431
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131139
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33778682 splice site probably null
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1511:Letm1 UTSW 5 33752555 missense probably damaging 1.00
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33769515 frame shift probably null
R2292:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTCTCAGTGGCAGGAAGAGGC -3'
(R):5'- GGGCTAGGGATTCACATGAACCATTTG -3'

Sequencing Primer
(F):5'- aggaggaggaggaaaaggag -3'
(R):5'- TTCTTGCAGTGAGCAGCAGT -3'
Posted On2013-05-23