Incidental Mutation 'R0466:Olfr845'
ID41642
Institutional Source Beutler Lab
Gene Symbol Olfr845
Ensembl Gene ENSMUSG00000061614
Gene Nameolfactory receptor 845
SynonymsOlfr1522-ps1, MOR150-2, MOR150-1P, GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-1
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19336457-19341718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19339179 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 240 (T240S)
Ref Sequence ENSEMBL: ENSMUSP00000150474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071259] [ENSMUST00000213344] [ENSMUST00000215572]
Predicted Effect probably damaging
Transcript: ENSMUST00000071259
AA Change: T240S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071239
Gene: ENSMUSG00000061614
AA Change: T240S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212246
AA Change: T240S
Predicted Effect probably damaging
Transcript: ENSMUST00000213344
AA Change: T240S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215572
AA Change: T240S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Olfr845
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr845 APN 9 19338772 missense possibly damaging 0.56
IGL01637:Olfr845 APN 9 19338964 missense probably damaging 1.00
IGL01767:Olfr845 APN 9 19339302 missense possibly damaging 0.54
IGL01945:Olfr845 APN 9 19339332 missense probably damaging 0.98
IGL02202:Olfr845 APN 9 19339249 missense probably benign 0.06
IGL02877:Olfr845 APN 9 19339201 missense possibly damaging 0.86
R1521:Olfr845 UTSW 9 19338652 missense probably benign 0.35
R1650:Olfr845 UTSW 9 19338647 missense possibly damaging 0.49
R1766:Olfr845 UTSW 9 19338858 missense probably benign 0.06
R2060:Olfr845 UTSW 9 19339056 missense probably benign 0.01
R2082:Olfr845 UTSW 9 19339278 missense probably benign 0.36
R2257:Olfr845 UTSW 9 19338493 missense probably benign 0.01
R2892:Olfr845 UTSW 9 19338738 missense probably benign 0.04
R3156:Olfr845 UTSW 9 19339424 unclassified probably null
R3943:Olfr845 UTSW 9 19339075 missense probably benign 0.05
R4116:Olfr845 UTSW 9 19338644 missense probably benign 0.39
R4518:Olfr845 UTSW 9 19339260 missense possibly damaging 0.86
R4814:Olfr845 UTSW 9 19339180 missense probably damaging 1.00
R5339:Olfr845 UTSW 9 19339159 missense possibly damaging 0.78
R6647:Olfr845 UTSW 9 19338629 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCACAGAGGTTGAAATCCCACAC -3'
(R):5'- CTGAGTCCCTTGAAATCCAGCCAC -3'

Sequencing Primer
(F):5'- CTGTGAACTTGCTCAGATCATAAAGC -3'
(R):5'- GGAAGCTATCCTTCCAACGTG -3'
Posted On2013-05-23