Incidental Mutation 'R0466:Ttll6'
ID41650
Institutional Source Beutler Lab
Gene Symbol Ttll6
Ensembl Gene ENSMUSG00000038756
Gene Nametubulin tyrosine ligase-like family, member 6
SynonymsD11Moh43e, t8130b59, 4932418K24Rik, D11Moh44e
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96133786-96165451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96145591 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 349 (L349M)
Ref Sequence ENSEMBL: ENSMUSP00000127778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107680] [ENSMUST00000167258]
Predicted Effect probably damaging
Transcript: ENSMUST00000107680
AA Change: L245M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103307
Gene: ENSMUSG00000038756
AA Change: L245M

DomainStartEndE-ValueType
Pfam:TTL 1 293 4.4e-90 PFAM
coiled coil region 376 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167258
AA Change: L349M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127778
Gene: ENSMUSG00000038756
AA Change: L349M

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
Pfam:TTL 103 397 2.9e-90 PFAM
coiled coil region 480 506 N/A INTRINSIC
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Ttll6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ttll6 APN 11 96135540 nonsense probably null
IGL02331:Ttll6 APN 11 96135747 missense probably damaging 1.00
IGL02490:Ttll6 APN 11 96156720 missense possibly damaging 0.55
IGL02551:Ttll6 APN 11 96154700 missense probably benign 0.00
IGL02618:Ttll6 APN 11 96147562 missense probably benign 0.04
IGL02712:Ttll6 APN 11 96139775 critical splice donor site probably benign
IGL02720:Ttll6 APN 11 96152073 critical splice donor site probably null
IGL02839:Ttll6 APN 11 96158820 missense probably damaging 1.00
IGL02974:Ttll6 APN 11 96156702 missense probably benign 0.06
IGL03038:Ttll6 APN 11 96151960 missense probably damaging 1.00
IGL03216:Ttll6 APN 11 96152014 missense probably benign 0.00
IGL03271:Ttll6 APN 11 96156687 missense probably benign 0.00
LCD18:Ttll6 UTSW 11 96155258 intron probably benign
R0295:Ttll6 UTSW 11 96154714 missense probably benign 0.09
R0310:Ttll6 UTSW 11 96147556 missense probably benign 0.41
R0533:Ttll6 UTSW 11 96154756 missense probably benign 0.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1453:Ttll6 UTSW 11 96158888 missense possibly damaging 0.82
R1555:Ttll6 UTSW 11 96145582 missense probably damaging 1.00
R1860:Ttll6 UTSW 11 96138874 nonsense probably null
R1861:Ttll6 UTSW 11 96138874 nonsense probably null
R1998:Ttll6 UTSW 11 96139775 critical splice donor site probably null
R2034:Ttll6 UTSW 11 96135526 missense probably damaging 0.99
R2126:Ttll6 UTSW 11 96147532 missense probably damaging 1.00
R3722:Ttll6 UTSW 11 96133921 missense probably benign 0.00
R4684:Ttll6 UTSW 11 96153177 missense probably benign
R4747:Ttll6 UTSW 11 96145546 missense possibly damaging 0.46
R4771:Ttll6 UTSW 11 96133829 missense possibly damaging 0.53
R4955:Ttll6 UTSW 11 96138789 missense possibly damaging 0.87
R5042:Ttll6 UTSW 11 96154604 missense possibly damaging 0.95
R5910:Ttll6 UTSW 11 96135589 missense possibly damaging 0.90
R5951:Ttll6 UTSW 11 96145510 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6134:Ttll6 UTSW 11 96139742 missense possibly damaging 0.69
R6263:Ttll6 UTSW 11 96156545 missense probably benign
R6325:Ttll6 UTSW 11 96135505 missense probably damaging 1.00
R6395:Ttll6 UTSW 11 96156588 missense probably benign 0.05
R6453:Ttll6 UTSW 11 96158727 missense probably benign 0.00
R6681:Ttll6 UTSW 11 96138863 missense probably damaging 1.00
R7481:Ttll6 UTSW 11 96154846 missense probably benign
X0022:Ttll6 UTSW 11 96158741 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCATCAGCATCGGCATCTC -3'
(R):5'- ATTCCTCAGCTAAGCGTGACACCC -3'

Sequencing Primer
(F):5'- GGACCAGGAATGATTCCCCTC -3'
(R):5'- CACGACTAAGGGGAAGTCAA -3'
Posted On2013-05-23