Incidental Mutation 'R0466:Cbs'
Institutional Source Beutler Lab
Gene Symbol Cbs
Ensembl Gene ENSMUSG00000024039
Gene Namecystathionine beta-synthase
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.690) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosomal Location31612623-31637199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31616152 bp
Amino Acid Change Alanine to Valine at position 450 (A450V)
Ref Sequence ENSEMBL: ENSMUSP00000113209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067801] [ENSMUST00000078509] [ENSMUST00000118504]
Predicted Effect probably benign
Transcript: ENSMUST00000067801
AA Change: A450V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066878
Gene: ENSMUSG00000024039
AA Change: A450V

Pfam:PALP 77 373 3.7e-66 PFAM
CBS 417 465 5.9e-11 SMART
Blast:CBS 482 553 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000078509
AA Change: A450V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077597
Gene: ENSMUSG00000024039
AA Change: A450V

Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118504
AA Change: A450V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113209
Gene: ENSMUSG00000024039
AA Change: A450V

Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151597
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Homozygous targeted mutants are severely growth retarded and die within 5 weeks of birth with enlarged multinucleate hepatocytes filled with lipid and massively elevated plasma homocysteine levels. Heterozygotes have twice normal homocysteine levels, butsurvive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Cbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Cbs APN 17 31621514 missense possibly damaging 0.90
IGL02030:Cbs APN 17 31625489 critical splice donor site probably null
IGL02089:Cbs APN 17 31615545 missense probably benign 0.13
IGL02274:Cbs APN 17 31625948 unclassified probably null
IGL02733:Cbs APN 17 31625031 missense probably benign 0.01
PIT4418001:Cbs UTSW 17 31615521 missense possibly damaging 0.89
R0334:Cbs UTSW 17 31619156 missense probably damaging 1.00
R0398:Cbs UTSW 17 31617242 missense probably benign 0.01
R0732:Cbs UTSW 17 31625029 missense probably benign 0.00
R1125:Cbs UTSW 17 31632831 missense probably benign 0.00
R1586:Cbs UTSW 17 31622474 missense probably damaging 1.00
R1646:Cbs UTSW 17 31613195 missense probably benign 0.00
R1728:Cbs UTSW 17 31620949 missense probably benign 0.35
R1729:Cbs UTSW 17 31620949 missense probably benign 0.35
R1784:Cbs UTSW 17 31620949 missense probably benign 0.35
R1823:Cbs UTSW 17 31624271 missense probably damaging 1.00
R2200:Cbs UTSW 17 31624264 missense probably damaging 1.00
R3829:Cbs UTSW 17 31617381 splice site probably benign
R3892:Cbs UTSW 17 31616074 missense probably benign 0.06
R4073:Cbs UTSW 17 31633005 missense possibly damaging 0.80
R4089:Cbs UTSW 17 31633006 missense probably benign 0.03
R4799:Cbs UTSW 17 31632852 missense probably damaging 0.99
R5029:Cbs UTSW 17 31615482 missense possibly damaging 0.85
R5194:Cbs UTSW 17 31624224 splice site probably null
R5244:Cbs UTSW 17 31617160 missense probably damaging 1.00
R5660:Cbs UTSW 17 31624246 missense probably damaging 1.00
R5890:Cbs UTSW 17 31613219 missense probably damaging 0.97
R5935:Cbs UTSW 17 31632879 missense probably damaging 0.98
R5936:Cbs UTSW 17 31625094 missense probably damaging 0.98
R6891:Cbs UTSW 17 31622457 missense probably damaging 1.00
R7126:Cbs UTSW 17 31619139 missense probably benign 0.09
R7220:Cbs UTSW 17 31619217 missense probably benign 0.00
R7343:Cbs UTSW 17 31619139 missense possibly damaging 0.74
X0025:Cbs UTSW 17 31616137 missense possibly damaging 0.94
X0057:Cbs UTSW 17 31632970 missense probably benign 0.01
X0067:Cbs UTSW 17 31627555 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtgatggtggcagttagag -3'
Posted On2013-05-23