Incidental Mutation 'R0466:Pcdhb5'
ID41666
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37322543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 659 (V659M)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000078271
AA Change: V659M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: V659M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 intron probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37322084 missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37322559 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37321402 nonsense probably null
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37321469 nonsense probably null
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37320752 missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37321773 missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37321686 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTAGACGACAATGACAATGCGCC -3'
(R):5'- TGAACTCACCAGTCCCAGATTCTCC -3'

Sequencing Primer
(F):5'- CTGGATACCTGGTCACCAAG -3'
(R):5'- CCTGTTAGACACATGTCATACTGG -3'
Posted On2013-05-23