Incidental Mutation 'R0467:Mcm3'
ID41672
Institutional Source Beutler Lab
Gene Symbol Mcm3
Ensembl Gene ENSMUSG00000041859
Gene Nameminichromosome maintenance complex component 3
SynonymsP1, p1.m, Mcmd
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20802968-20820312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20804847 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 737 (D737G)
Ref Sequence ENSEMBL: ENSMUSP00000059192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053266]
Predicted Effect probably benign
Transcript: ENSMUST00000053266
AA Change: D737G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859
AA Change: D737G

DomainStartEndE-ValueType
MCM 109 654 N/A SMART
AAA 337 490 1.92e-4 SMART
coiled coil region 655 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191061
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Mcm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Mcm3 APN 1 20804815 critical splice donor site probably null
IGL01061:Mcm3 APN 1 20814496 missense possibly damaging 0.86
IGL01488:Mcm3 APN 1 20813056 missense possibly damaging 0.90
IGL01609:Mcm3 APN 1 20814680 splice site probably benign
IGL02483:Mcm3 APN 1 20803572 missense possibly damaging 0.68
IGL02869:Mcm3 APN 1 20808839 missense probably damaging 0.99
R0197:Mcm3 UTSW 1 20810105 missense probably damaging 1.00
R0462:Mcm3 UTSW 1 20805332 missense probably benign
R0669:Mcm3 UTSW 1 20804929 intron probably null
R1251:Mcm3 UTSW 1 20812672 nonsense probably null
R1599:Mcm3 UTSW 1 20820198 missense probably benign 0.08
R1764:Mcm3 UTSW 1 20805879 missense probably damaging 0.98
R2015:Mcm3 UTSW 1 20803580 missense probably damaging 0.98
R2140:Mcm3 UTSW 1 20813110 missense probably benign 0.00
R3033:Mcm3 UTSW 1 20808768 missense probably damaging 1.00
R4430:Mcm3 UTSW 1 20811993 nonsense probably null
R4513:Mcm3 UTSW 1 20810232 missense probably damaging 1.00
R4563:Mcm3 UTSW 1 20809645 missense probably benign
R4713:Mcm3 UTSW 1 20803577 missense probably benign
R4801:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4802:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4896:Mcm3 UTSW 1 20820256 utr 5 prime probably benign
R5035:Mcm3 UTSW 1 20803418 utr 3 prime probably benign
R5461:Mcm3 UTSW 1 20814437 missense probably benign 0.00
R5486:Mcm3 UTSW 1 20814894 missense probably damaging 1.00
R5531:Mcm3 UTSW 1 20803544 missense possibly damaging 0.46
R5759:Mcm3 UTSW 1 20808748 frame shift probably null
R5760:Mcm3 UTSW 1 20808748 frame shift probably null
R6505:Mcm3 UTSW 1 20803544 missense probably damaging 1.00
R6833:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R6834:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R7179:Mcm3 UTSW 1 20814857 missense probably damaging 0.98
X0062:Mcm3 UTSW 1 20820137 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CAAGCAGTTCTGCCAAATCGCC -3'
(R):5'- GTGACCTATGTCATGCCTGCTGAG -3'

Sequencing Primer
(F):5'- GCCACAGCCTTTAGACACTG -3'
(R):5'- CCCCTTAGGAATCATGGGAGAC -3'
Posted On2013-05-23