Incidental Mutation 'R0467:Pcdhb14'
ID41717
Institutional Source Beutler Lab
Gene Symbol Pcdhb14
Ensembl Gene ENSMUSG00000044043
Gene Nameprotocadherin beta 14
SynonymsPcdhbN, 2210006M07Rik, Pcdhb17
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37447656-37456350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37449224 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 461 (R461L)
Ref Sequence ENSEMBL: ENSMUSP00000054111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
PDB Structure
Solution structure of mouse protocadherin beta 14 (26-137) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000052387
AA Change: R461L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043
AA Change: R461L

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Pcdhb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pcdhb14 APN 18 37450033 missense probably benign 0.28
IGL02314:Pcdhb14 APN 18 37450195 missense probably benign 0.03
IGL02411:Pcdhb14 APN 18 37449770 missense possibly damaging 0.78
IGL02553:Pcdhb14 APN 18 37448018 nonsense probably null
IGL02797:Pcdhb14 APN 18 37449851 missense probably damaging 1.00
IGL03184:Pcdhb14 APN 18 37449032 missense probably benign 0.00
IGL03352:Pcdhb14 APN 18 37449004 missense possibly damaging 0.67
R0166:Pcdhb14 UTSW 18 37448489 unclassified probably null
R0675:Pcdhb14 UTSW 18 37448339 missense possibly damaging 0.91
R0730:Pcdhb14 UTSW 18 37448868 missense probably damaging 1.00
R1119:Pcdhb14 UTSW 18 37448587 missense probably damaging 0.99
R1121:Pcdhb14 UTSW 18 37449592 missense probably damaging 1.00
R1338:Pcdhb14 UTSW 18 37449890 missense probably benign 0.00
R1726:Pcdhb14 UTSW 18 37449594 nonsense probably null
R1743:Pcdhb14 UTSW 18 37448178 missense probably benign 0.01
R1779:Pcdhb14 UTSW 18 37449482 missense probably damaging 1.00
R1795:Pcdhb14 UTSW 18 37449535 missense probably benign
R2131:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R2133:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R3792:Pcdhb14 UTSW 18 37449662 missense probably damaging 1.00
R3916:Pcdhb14 UTSW 18 37448545 missense possibly damaging 0.48
R4197:Pcdhb14 UTSW 18 37448305 missense probably benign 0.01
R4282:Pcdhb14 UTSW 18 37450142 missense probably damaging 1.00
R4657:Pcdhb14 UTSW 18 37448847 missense possibly damaging 0.92
R4801:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R4802:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R5022:Pcdhb14 UTSW 18 37450170 missense probably benign 0.03
R5034:Pcdhb14 UTSW 18 37448806 missense probably damaging 0.98
R5664:Pcdhb14 UTSW 18 37448996 missense possibly damaging 0.54
R5840:Pcdhb14 UTSW 18 37448750 missense probably benign 0.23
R5966:Pcdhb14 UTSW 18 37448242 missense probably benign
R6090:Pcdhb14 UTSW 18 37448606 missense probably benign 0.45
R6148:Pcdhb14 UTSW 18 37449230 missense probably damaging 1.00
R6187:Pcdhb14 UTSW 18 37448444 missense probably damaging 1.00
R6972:Pcdhb14 UTSW 18 37449692 missense probably damaging 1.00
X0065:Pcdhb14 UTSW 18 37449421 missense possibly damaging 0.95
X0065:Pcdhb14 UTSW 18 37449984 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCAGAGCTGAGTACAACATCACC -3'
(R):5'- GCATTGTCATTGTCGTCCAGCACC -3'

Sequencing Primer
(F):5'- TGAGTACAACATCACCATTACGGTC -3'
(R):5'- ATAGTCCAGCGCCCTGAG -3'
Posted On2013-05-23