Incidental Mutation 'R0470:Setd1a'
ID41798
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene NameSET domain containing 1A
SynonymsKMT2F
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0470 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127776670-127800122 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 127785057 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: R360H
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: R360H

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: R360H
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: R360H

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141439
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Cfhr2 A T 1: 139,821,779 V155E probably damaging Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cilp2 A T 8: 69,885,405 V192E possibly damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tgfb1 T A 7: 25,687,930 probably benign Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Trim66 A G 7: 109,457,542 probably benign Het
Tspoap1 T C 11: 87,776,162 S1027P probably damaging Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r109 T C 17: 20,552,886 Q491R probably benign Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Wisp1 A G 15: 66,917,378 I238V probably benign Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127785326 unclassified probably benign
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0411:Setd1a UTSW 7 127796051 unclassified probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127799155 unclassified probably benign
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6189:Setd1a UTSW 7 127778283 splice site probably null
R6250:Setd1a UTSW 7 127791299 missense unknown
R7131:Setd1a UTSW 7 127796418 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCACATAGGTAGGAGCCTAGC -3'
(R):5'- AGCAAAGGGCACACTCTCGTTG -3'

Sequencing Primer
(F):5'- CATAGGTAGGAGCCTAGCTAACTC -3'
(R):5'- caccaccaccaccactac -3'
Posted On2013-05-23