Incidental Mutation 'R0477:Adamts3'
ID41845
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms6330442E02Rik, 1100001H14Rik
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0477 (G1)
Quality Score182
Status Validated (trace)
Chromosome5
Chromosomal Location89677087-89883334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89684507 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 913 (D913E)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: D912E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: D912E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122551
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: D913E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: D913E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Meta Mutation Damage Score 0.1068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGGTTTGTCCCTACCACAAACG -3'
(R):5'- CCCTCTGTTGTTCAAAAGCAAAGCG -3'

Sequencing Primer
(F):5'- CGCTGTCTGAAAGTGTTAATTTTCC -3'
(R):5'- TTCAAAAGCAAAGCGTTGGGAC -3'
Posted On2013-05-23