Incidental Mutation 'R0477:Foxc2'
ID41854
Institutional Source Beutler Lab
Gene Symbol Foxc2
Ensembl Gene ENSMUSG00000046714
Gene Nameforkhead box C2
SynonymsMfh1, Fkh14, MFH-1, Hfhbf3
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0477 (G1)
Quality Score106
Status Validated (trace)
Chromosome8
Chromosomal Location121116171-121118895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121118035 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 474 (Y474F)
Ref Sequence ENSEMBL: ENSMUSP00000055290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054691] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000054691
AA Change: Y474F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055290
Gene: ENSMUSG00000046714
AA Change: Y474F

DomainStartEndE-ValueType
FH 69 159 2.11e-63 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 203 220 N/A INTRINSIC
low complexity region 288 312 N/A INTRINSIC
low complexity region 379 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the development of mesenchymal tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die perinatally or before with cardiac abnormalities and skeletal defects in the neurocranium and spine. Heterozygotes exhibit lymphatic vessel and lymph node hyperplasia, anterior segment defects, and distichiasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Foxc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Foxc2 APN 8 121117837 missense probably benign 0.10
IGL02973:Foxc2 APN 8 121118049 missense probably benign
R0211:Foxc2 UTSW 8 121116616 start codon destroyed probably null 0.77
R1589:Foxc2 UTSW 8 121117176 missense probably benign
R1859:Foxc2 UTSW 8 121116625 missense probably damaging 0.98
R1965:Foxc2 UTSW 8 121116674 missense probably damaging 0.99
R2104:Foxc2 UTSW 8 121118080 missense probably damaging 1.00
R4274:Foxc2 UTSW 8 121117700 missense probably benign 0.30
R4392:Foxc2 UTSW 8 121117452 missense probably damaging 0.98
Z1088:Foxc2 UTSW 8 121116959 missense possibly damaging 0.95
Z1088:Foxc2 UTSW 8 121117150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCAGTGCAGTATGCGGGCTATG -3'
(R):5'- AGCTGCGGATAAGTTACCTGCGAG -3'

Sequencing Primer
(F):5'- CGGGCTATGAGTCTGTACAC -3'
(R):5'- AAGTTACCTGCGAGTTGCAC -3'
Posted On2013-05-23