Incidental Mutation 'R0477:Tmprss5'
ID41856
Institutional Source Beutler Lab
Gene Symbol Tmprss5
Ensembl Gene ENSMUSG00000032268
Gene Nametransmembrane protease, serine 5 (spinesin)
Synonymsspinesin
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0477 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location49081260-49117587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49115165 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 383 (D383G)
Ref Sequence ENSEMBL: ENSMUSP00000129482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070390] [ENSMUST00000165088] [ENSMUST00000166272] [ENSMUST00000167095] [ENSMUST00000170246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070390
AA Change: D389G

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064527
Gene: ENSMUSG00000032268
AA Change: D389G

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:SRCR_2 106 203 4.2e-38 PFAM
Tryp_SPc 207 438 1.28e-90 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165088
AA Change: D399G

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132181
Gene: ENSMUSG00000032268
AA Change: D399G

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:SRCR_2 116 213 2.9e-38 PFAM
Tryp_SPc 217 448 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166272
SMART Domains Protein: ENSMUSP00000130069
Gene: ENSMUSG00000032268

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167095
AA Change: D325G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131650
Gene: ENSMUSG00000032268
AA Change: D325G

DomainStartEndE-ValueType
Pfam:SRCR_2 42 139 1.1e-38 PFAM
Tryp_SPc 143 374 1.28e-90 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170246
AA Change: D383G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129482
Gene: ENSMUSG00000032268
AA Change: D383G

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:SRCR_2 100 197 1.4e-38 PFAM
Tryp_SPc 201 432 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170426
SMART Domains Protein: ENSMUSP00000128662
Gene: ENSMUSG00000032268

DomainStartEndE-ValueType
Pfam:SRCR_2 7 84 3.4e-28 PFAM
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. Serine proteases are known to be involved in many physiological and pathological processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Tmprss5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Tmprss5 APN 9 49109457 makesense probably null
IGL02705:Tmprss5 APN 9 49107147 missense probably benign 0.19
IGL03072:Tmprss5 APN 9 49109018 missense possibly damaging 0.68
IGL03107:Tmprss5 APN 9 49113228 missense possibly damaging 0.78
PIT4366001:Tmprss5 UTSW 9 49112217 missense probably benign 0.24
R0207:Tmprss5 UTSW 9 49113160 missense possibly damaging 0.88
R1542:Tmprss5 UTSW 9 49109134 missense possibly damaging 0.81
R1819:Tmprss5 UTSW 9 49107164 missense probably benign 0.09
R2395:Tmprss5 UTSW 9 49115135 nonsense probably null
R4600:Tmprss5 UTSW 9 49113248 missense possibly damaging 0.67
R4967:Tmprss5 UTSW 9 49115517 missense probably damaging 0.98
R5819:Tmprss5 UTSW 9 49114479 splice site probably null
R7266:Tmprss5 UTSW 9 49114541 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCCTTTGGCCCAGGTCCATAG -3'
(R):5'- TGGAGCAGCACCAGTCTACCATAAG -3'

Sequencing Primer
(F):5'- TGTCCTGAGGAGCTATGACTC -3'
(R):5'- CTACCATAAGGAATGAATTCTCCTGG -3'
Posted On2013-05-23