Incidental Mutation 'R0477:Trim43b'
ID41857
Institutional Source Beutler Lab
Gene Symbol Trim43b
Ensembl Gene ENSMUSG00000079162
Gene Nametripartite motif-containing 43B
SynonymsGm8269
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0477 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location89084624-89092835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89090601 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 167 (W167R)
Ref Sequence ENSEMBL: ENSMUSP00000139457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167113] [ENSMUST00000189557]
Predicted Effect probably benign
Transcript: ENSMUST00000167113
AA Change: W167R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126594
Gene: ENSMUSG00000079162
AA Change: W167R

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 4e-8 BLAST
PDB:2VOK|B 329 445 3e-15 PDB
Blast:SPRY 336 441 9e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000189557
AA Change: W167R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139457
Gene: ENSMUSG00000079162
AA Change: W167R

DomainStartEndE-ValueType
RING 16 56 4.7e-9 SMART
Blast:BBOX 88 129 4e-8 BLAST
SPRY 334 444 8.1e-5 SMART
Meta Mutation Damage Score 0.0364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Trim43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Trim43b APN 9 89091642 missense probably benign 0.04
IGL01953:Trim43b APN 9 89085443 missense possibly damaging 0.74
IGL02160:Trim43b APN 9 89091630 missense probably benign 0.35
IGL02626:Trim43b APN 9 89085488 missense possibly damaging 0.89
IGL03199:Trim43b APN 9 89089428 missense probably damaging 0.98
R1345:Trim43b UTSW 9 89085672 missense possibly damaging 0.77
R1491:Trim43b UTSW 9 89087612 missense possibly damaging 0.52
R1536:Trim43b UTSW 9 89085358 nonsense probably null
R1862:Trim43b UTSW 9 89085571 missense probably damaging 1.00
R2211:Trim43b UTSW 9 89085249 missense possibly damaging 0.91
R4039:Trim43b UTSW 9 89091347 missense probably damaging 1.00
R4222:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4223:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4224:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4726:Trim43b UTSW 9 89089485 missense possibly damaging 0.70
R4812:Trim43b UTSW 9 89091480 missense probably benign 0.05
R4887:Trim43b UTSW 9 89091312 missense probably damaging 0.99
R5865:Trim43b UTSW 9 89085606 missense probably benign 0.19
R5909:Trim43b UTSW 9 89085398 missense possibly damaging 0.94
R6226:Trim43b UTSW 9 89091275 missense possibly damaging 0.82
R6378:Trim43b UTSW 9 89085399 missense probably benign 0.08
R6531:Trim43b UTSW 9 89085365 missense probably damaging 1.00
R7114:Trim43b UTSW 9 89085608 missense probably benign 0.04
V5622:Trim43b UTSW 9 89092545 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGGAATTTAAAGCTTGAGGTAGGGTGC -3'
(R):5'- TGAGAATTATCCAGCCAGTCGTCAAC -3'

Sequencing Primer
(F):5'- GGTGCTGTTTCACTAACATGCC -3'
(R):5'- aaaaataaCACTGTGATCCTTCTACC -3'
Posted On2013-05-23