Incidental Mutation 'R0477:Zkscan7'
ID41858
Institutional Source Beutler Lab
Gene Symbol Zkscan7
Ensembl Gene ENSMUSG00000063488
Gene Namezinc finger with KRAB and SCAN domains 7
SynonymsZfp167
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0477 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location122885685-122898618 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 122890809 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063980] [ENSMUST00000215872]
Predicted Effect probably null
Transcript: ENSMUST00000063980
SMART Domains Protein: ENSMUSP00000071695
Gene: ENSMUSG00000063488

DomainStartEndE-ValueType
SCAN 45 156 1.18e-65 SMART
ZnF_C2H2 350 372 5.59e-4 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 434 456 8.4e1 SMART
ZnF_C2H2 487 509 4.24e-4 SMART
ZnF_C2H2 515 537 8.34e-3 SMART
ZnF_C2H2 543 565 7.37e-4 SMART
ZnF_C2H2 571 593 1.92e-2 SMART
ZnF_C2H2 599 621 1.13e-4 SMART
ZnF_C2H2 627 649 2.24e-3 SMART
ZnF_C2H2 655 677 4.17e-3 SMART
ZnF_C2H2 683 705 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214426
Predicted Effect probably null
Transcript: ENSMUST00000215872
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Other mutations in Zkscan7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Zkscan7 APN 9 122895594 missense possibly damaging 0.95
IGL01650:Zkscan7 APN 9 122894827 missense probably benign
IGL01905:Zkscan7 APN 9 122890761 missense possibly damaging 0.93
IGL02466:Zkscan7 APN 9 122888885 missense probably damaging 0.98
R0310:Zkscan7 UTSW 9 122888893 nonsense probably null
R0355:Zkscan7 UTSW 9 122888807 missense probably damaging 1.00
R1276:Zkscan7 UTSW 9 122890723 missense probably damaging 0.98
R1426:Zkscan7 UTSW 9 122895163 missense probably benign
R2055:Zkscan7 UTSW 9 122888937 missense probably damaging 1.00
R2195:Zkscan7 UTSW 9 122895621 missense possibly damaging 0.73
R2354:Zkscan7 UTSW 9 122894827 missense probably benign
R4878:Zkscan7 UTSW 9 122890800 nonsense probably null
R5106:Zkscan7 UTSW 9 122896133 unclassified probably benign
R6266:Zkscan7 UTSW 9 122895234 nonsense probably null
R6299:Zkscan7 UTSW 9 122888717 missense probably damaging 1.00
R6513:Zkscan7 UTSW 9 122896105 missense probably benign 0.00
R6881:Zkscan7 UTSW 9 122888701 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACACACTTGTGCCGATGCACC -3'
(R):5'- AGACTGCTCTGGCTTGAGGGAAAC -3'

Sequencing Primer
(F):5'- TCTAGCTCCTACAAGGAGAGTCTG -3'
(R):5'- GGGAAACTTGGTAAGTACATGC -3'
Posted On2013-05-23