Incidental Mutation 'R0477:Rabep1'
ID41863
Institutional Source Beutler Lab
Gene Symbol Rabep1
Ensembl Gene ENSMUSG00000020817
Gene Namerabaptin, RAB GTPase binding effector protein 1
Synonymsneurocrescin, RAB5 effector protein, rabaptin-5
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R0477 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location70844778-70943105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70920907 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 535 (M535R)
Ref Sequence ENSEMBL: ENSMUSP00000080102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
Predicted Effect probably benign
Transcript: ENSMUST00000076270
AA Change: M575R

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817
AA Change: M575R

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081362
AA Change: M535R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817
AA Change: M535R

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100928
AA Change: M540R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817
AA Change: M540R

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108533
AA Change: M575R

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817
AA Change: M575R

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142220
Predicted Effect probably benign
Transcript: ENSMUST00000177731
AA Change: M491R

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817
AA Change: M491R

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178245
AA Change: M532R

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817
AA Change: M532R

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Rabep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rabep1 APN 11 70925781 missense probably benign 0.00
IGL02022:Rabep1 APN 11 70934559 missense probably damaging 1.00
IGL02215:Rabep1 APN 11 70923197 nonsense probably null
IGL02428:Rabep1 APN 11 70917480 missense probably benign 0.00
IGL02566:Rabep1 APN 11 70917714 missense probably damaging 1.00
IGL02868:Rabep1 APN 11 70874746 missense probably benign 0.00
F5770:Rabep1 UTSW 11 70937516 splice site probably benign
P0042:Rabep1 UTSW 11 70884975 splice site probably benign
PIT4495001:Rabep1 UTSW 11 70917579 missense probably damaging 1.00
R0328:Rabep1 UTSW 11 70919207 missense probably damaging 1.00
R0458:Rabep1 UTSW 11 70886998 splice site probably null
R0727:Rabep1 UTSW 11 70900492 nonsense probably null
R1732:Rabep1 UTSW 11 70904641 missense probably damaging 1.00
R1837:Rabep1 UTSW 11 70904658 missense probably damaging 1.00
R2203:Rabep1 UTSW 11 70934574 missense probably damaging 1.00
R4003:Rabep1 UTSW 11 70917367 missense probably benign 0.12
R4229:Rabep1 UTSW 11 70908434 missense probably benign
R4573:Rabep1 UTSW 11 70917751 missense probably damaging 1.00
R4748:Rabep1 UTSW 11 70908468 missense probably benign 0.18
R5130:Rabep1 UTSW 11 70904731 missense probably damaging 1.00
R5182:Rabep1 UTSW 11 70904628 nonsense probably null
R5379:Rabep1 UTSW 11 70908421 missense probably damaging 1.00
R5525:Rabep1 UTSW 11 70923146 missense probably damaging 1.00
R5617:Rabep1 UTSW 11 70917529 missense probably damaging 1.00
R6283:Rabep1 UTSW 11 70917679 missense probably damaging 1.00
R6302:Rabep1 UTSW 11 70935121 missense probably damaging 1.00
R6730:Rabep1 UTSW 11 70940386 missense possibly damaging 0.88
R6988:Rabep1 UTSW 11 70934537 missense probably damaging 0.96
R7235:Rabep1 UTSW 11 70940464 missense probably benign 0.43
R7241:Rabep1 UTSW 11 70939989 missense probably damaging 1.00
R7453:Rabep1 UTSW 11 70917660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCGTCTTGGAGGCAT -3'
(R):5'- CCAGAGCCGTCGGAGACATTAGAA -3'

Sequencing Primer
(F):5'- tgtgaaaagctgttgctaactg -3'
(R):5'- tgaccctcttctgaccttcc -3'
Posted On2013-05-23