Incidental Mutation 'R0477:Nlrp4f'
ID41871
Institutional Source Beutler Lab
Gene Symbol Nlrp4f
Ensembl Gene ENSMUSG00000032999
Gene NameNLR family, pyrin domain containing 4F
SynonymsNalp-kappa, Nalp4f, C330026N02Rik
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0477 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location65177111-65205977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65190906 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 639 (R639L)
Ref Sequence ENSEMBL: ENSMUSP00000152418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037372] [ENSMUST00000220448] [ENSMUST00000221659] [ENSMUST00000222514] [ENSMUST00000222559] [ENSMUST00000223418]
Predicted Effect probably benign
Transcript: ENSMUST00000037372
AA Change: R639L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000041908
Gene: ENSMUSG00000032999
AA Change: R639L

DomainStartEndE-ValueType
PYRIN 6 88 1.44e-26 SMART
Pfam:NACHT 147 316 3.4e-39 PFAM
LRR 632 659 1.18e1 SMART
LRR 686 713 4.22e1 SMART
LRR 715 742 5.66e1 SMART
LRR 743 769 4.03e0 SMART
LRR 771 798 1.17e0 SMART
LRR 799 826 1.43e-1 SMART
LRR 828 855 1.03e-2 SMART
LRR 856 883 5.59e-4 SMART
LRR 885 912 2.91e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220448
Predicted Effect probably benign
Transcript: ENSMUST00000221659
AA Change: R639L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000222514
AA Change: R639L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000222559
Predicted Effect probably benign
Transcript: ENSMUST00000223418
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Nlrp4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Nlrp4f APN 13 65195543 nonsense probably null
IGL01676:Nlrp4f APN 13 65195119 missense possibly damaging 0.95
IGL01701:Nlrp4f APN 13 65199409 missense probably damaging 1.00
IGL01799:Nlrp4f APN 13 65187462 missense probably benign 0.03
IGL02084:Nlrp4f APN 13 65194171 nonsense probably null
IGL02234:Nlrp4f APN 13 65194488 missense probably damaging 1.00
IGL02481:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02483:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02625:Nlrp4f APN 13 65199271 missense probably damaging 1.00
IGL02814:Nlrp4f APN 13 65185042 missense probably damaging 0.98
IGL03077:Nlrp4f APN 13 65194598 missense probably benign 0.10
IGL03111:Nlrp4f APN 13 65183002 missense probably damaging 1.00
IGL03175:Nlrp4f APN 13 65194596 missense probably damaging 1.00
IGL03324:Nlrp4f APN 13 65195228 missense possibly damaging 0.91
R0398:Nlrp4f UTSW 13 65194918 missense possibly damaging 0.79
R0707:Nlrp4f UTSW 13 65194503 missense probably benign 0.42
R1052:Nlrp4f UTSW 13 65185083 missense possibly damaging 0.73
R1302:Nlrp4f UTSW 13 65194557 missense possibly damaging 0.77
R1460:Nlrp4f UTSW 13 65190268 missense probably benign 0.23
R1970:Nlrp4f UTSW 13 65194091 missense probably damaging 1.00
R2111:Nlrp4f UTSW 13 65199353 missense probably benign 0.11
R2272:Nlrp4f UTSW 13 65194408 missense probably benign 0.01
R2370:Nlrp4f UTSW 13 65190846 missense probably damaging 0.99
R2680:Nlrp4f UTSW 13 65194343 nonsense probably null
R3120:Nlrp4f UTSW 13 65194716 missense probably benign 0.13
R3737:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4035:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4107:Nlrp4f UTSW 13 65183065 missense probably benign 0.01
R4422:Nlrp4f UTSW 13 65184962 critical splice donor site probably null
R4718:Nlrp4f UTSW 13 65194989 missense probably benign 0.01
R5652:Nlrp4f UTSW 13 65182989 missense probably benign 0.00
R5656:Nlrp4f UTSW 13 65190871 nonsense probably null
R5912:Nlrp4f UTSW 13 65194908 missense probably damaging 0.99
R5915:Nlrp4f UTSW 13 65187555 missense probably damaging 1.00
R5955:Nlrp4f UTSW 13 65195081 missense probably benign 0.15
R6683:Nlrp4f UTSW 13 65199195 missense probably benign 0.01
R6742:Nlrp4f UTSW 13 65187440 critical splice donor site probably null
R6750:Nlrp4f UTSW 13 65181654 nonsense probably null
R6751:Nlrp4f UTSW 13 65194429 missense probably damaging 0.99
R7110:Nlrp4f UTSW 13 65199346 missense probably damaging 0.96
R7143:Nlrp4f UTSW 13 65195306 missense probably damaging 1.00
R7143:Nlrp4f UTSW 13 65199352 missense possibly damaging 0.90
R7187:Nlrp4f UTSW 13 65195387 missense possibly damaging 0.47
R7230:Nlrp4f UTSW 13 65194901 missense probably benign 0.16
R7283:Nlrp4f UTSW 13 65195538 nonsense probably null
Z1088:Nlrp4f UTSW 13 65194302 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGAAAGCAGAGCCCTGCACG -3'
(R):5'- GGTCACTACCCTTACTCAGTATGGGAG -3'

Sequencing Primer
(F):5'- cgtgctttcatcatcataaacttc -3'
(R):5'- tgctggaaactggccttg -3'
Posted On2013-05-23