Incidental Mutation 'R0477:Fam107a'
ID41872
Institutional Source Beutler Lab
Gene Symbol Fam107a
Ensembl Gene ENSMUSG00000021750
Gene Namefamily with sequence similarity 107, member A
SynonymsDRR1
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0477 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location8296274-8318023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8301168 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 21 (Y21N)
Ref Sequence ENSEMBL: ENSMUSP00000120854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036070] [ENSMUST00000120411] [ENSMUST00000121887] [ENSMUST00000137133]
Predicted Effect probably benign
Transcript: ENSMUST00000036070
AA Change: Y21N

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045513
Gene: ENSMUSG00000021750
AA Change: Y21N

DomainStartEndE-ValueType
Pfam:DUF1151 21 133 4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120411
AA Change: Y21N

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112769
Gene: ENSMUSG00000021750
AA Change: Y21N

DomainStartEndE-ValueType
Pfam:DUF1151 16 133 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121887
AA Change: Y21N

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114015
Gene: ENSMUSG00000021750
AA Change: Y21N

DomainStartEndE-ValueType
Pfam:DUF1151 16 133 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137133
AA Change: Y21N

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120854
Gene: ENSMUSG00000021750
AA Change: Y21N

DomainStartEndE-ValueType
Pfam:DUF1151 16 99 2.8e-35 PFAM
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Fam107a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01940:Fam107a APN 14 8298766 missense probably benign 0.01
R4998:Fam107a UTSW 14 8299514 missense possibly damaging 0.61
R5546:Fam107a UTSW 14 8298764 missense probably benign 0.01
R6360:Fam107a UTSW 14 8299619 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGCTAGGTCAGCCCCTCTAAG -3'
(R):5'- CCGTTTCCCACAATAGAGAGGCAG -3'

Sequencing Primer
(F):5'- GAAGCATTTTTCTAAGCCAGCC -3'
(R):5'- GCAAGACTTGCATTATCAGGTAGC -3'
Posted On2013-05-23