Incidental Mutation 'R0477:Itih4'
ID41873
Institutional Source Beutler Lab
Gene Symbol Itih4
Ensembl Gene ENSMUSG00000021922
Gene Nameinter alpha-trypsin inhibitor, heavy chain 4
SynonymsItih-4
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0477 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location30886476-30902353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30889674 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 118 (V118D)
Ref Sequence ENSEMBL: ENSMUSP00000125920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006703] [ENSMUST00000078490] [ENSMUST00000120269] [ENSMUST00000168782]
Predicted Effect probably damaging
Transcript: ENSMUST00000006703
AA Change: V118D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006703
Gene: ENSMUSG00000021922
AA Change: V118D

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 781 941 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078490
AA Change: V118D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077580
Gene: ENSMUSG00000021922
AA Change: V118D

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 777 941 2.2e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120269
AA Change: V118D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112798
Gene: ENSMUSG00000021922
AA Change: V118D

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 738 902 6.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168782
AA Change: V118D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125920
Gene: ENSMUSG00000021922
AA Change: V118D

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 761 925 2.2e-45 PFAM
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors with diverse functions as anti-apoptotic and matrix stabilizing molecules during development. This gene is predominantly expressed in the liver and the encoded protein was found to be a plasma kallikrein-sensitive glycoprotein. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal. Surprisingly, IL-6/STAT3 signaling is significantly suppressed in mutant liver tissues but hepatocytes remain well differentiated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Itih4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itih4 APN 14 30895469 missense probably damaging 0.97
IGL00776:Itih4 APN 14 30889604 missense probably benign 0.03
IGL01309:Itih4 APN 14 30891749 missense probably damaging 1.00
IGL01433:Itih4 APN 14 30895448 missense probably benign 0.01
IGL01598:Itih4 APN 14 30887817 missense possibly damaging 0.92
IGL02332:Itih4 APN 14 30887860 missense probably damaging 1.00
IGL03075:Itih4 APN 14 30892283 missense probably benign 0.02
IGL03304:Itih4 APN 14 30898049 missense probably damaging 0.98
IGL03353:Itih4 APN 14 30887844 missense probably damaging 1.00
IGL03396:Itih4 APN 14 30887949 missense probably damaging 1.00
PIT4453001:Itih4 UTSW 14 30901170 missense probably benign 0.29
R0304:Itih4 UTSW 14 30890094 splice site probably null
R0783:Itih4 UTSW 14 30895423 missense possibly damaging 0.84
R0882:Itih4 UTSW 14 30892274 missense probably damaging 1.00
R1118:Itih4 UTSW 14 30896167 splice site probably benign
R1126:Itih4 UTSW 14 30889961 critical splice donor site probably null
R1238:Itih4 UTSW 14 30887949 missense probably damaging 1.00
R1456:Itih4 UTSW 14 30892653 missense probably benign 0.31
R1573:Itih4 UTSW 14 30897547 missense probably benign 0.00
R1695:Itih4 UTSW 14 30891499 critical splice donor site probably null
R2085:Itih4 UTSW 14 30892323 missense possibly damaging 0.91
R2093:Itih4 UTSW 14 30891737 missense probably damaging 1.00
R2213:Itih4 UTSW 14 30890713 missense probably damaging 0.99
R2249:Itih4 UTSW 14 30899394 nonsense probably null
R2267:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2268:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2508:Itih4 UTSW 14 30895478 missense probably damaging 1.00
R3724:Itih4 UTSW 14 30892584 missense possibly damaging 0.60
R3859:Itih4 UTSW 14 30892329 missense probably damaging 1.00
R4042:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4044:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4246:Itih4 UTSW 14 30891402 missense probably damaging 1.00
R4422:Itih4 UTSW 14 30889864 missense probably damaging 1.00
R4553:Itih4 UTSW 14 30900953 missense probably damaging 1.00
R4581:Itih4 UTSW 14 30900968 missense probably benign 0.01
R4608:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4609:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4726:Itih4 UTSW 14 30889835 missense probably damaging 1.00
R4790:Itih4 UTSW 14 30889910 missense probably damaging 1.00
R4975:Itih4 UTSW 14 30892287 missense probably damaging 1.00
R5004:Itih4 UTSW 14 30892672 missense probably damaging 1.00
R5911:Itih4 UTSW 14 30890655 missense possibly damaging 0.90
R6014:Itih4 UTSW 14 30892629 missense probably benign 0.01
R6957:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7012:Itih4 UTSW 14 30890749 missense probably benign 0.16
R7075:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7195:Itih4 UTSW 14 30899475 missense probably damaging 1.00
R7231:Itih4 UTSW 14 30896614 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGATGAAAGCCACTCCCAGTGTCC -3'
(R):5'- GTAGCTCATACATTCCCAGTCGCC -3'

Sequencing Primer
(F):5'- CCCCGTAGGTGCATAATAAATG -3'
(R):5'- GTTCGAAGGTAATCTTGGAACC -3'
Posted On2013-05-23