Incidental Mutation 'R0483:Col4a1'
ID42119
Institutional Source Beutler Lab
Gene Symbol Col4a1
Ensembl Gene ENSMUSG00000031502
Gene Namecollagen, type IV, alpha 1
SynonymsDel(8)Bru44H, Svc, Raw, Del(8)44H, Bru, Col4a-1, alpha1(IV) collagen
MMRRC Submission 038683-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0483 (G1)
Quality Score183
Status Validated
Chromosome8
Chromosomal Location11198423-11312826 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 11236423 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000209661] [ENSMUST00000209735]
Predicted Effect probably benign
Transcript: ENSMUST00000033898
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208386
Predicted Effect probably benign
Transcript: ENSMUST00000209661
Predicted Effect probably benign
Transcript: ENSMUST00000209735
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of two alpha-1 and one alpha-2 subunits that assembles into a type IV collagen network. This gene is located adjacent to the gene encoding alpha-2 subunit. Mice lacking both the alpha-1 and alpha-2 subunits of collagen IV die in utero due to structural deficiencies in the basement membranes and certain mutations in this gene cause perinatal cerebral hemorrhage and porencephaly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice with ENU induced alleles have various eye and vision defects and may show bruising at birth. Mice carrying the G498V mutation have renal glomerular defects that resolve within the first weeks of life, but show retinal tortuosity, muscular dystrophy, brain hemorrhages, and renal cysts as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik G A 10: 83,759,638 probably benign Het
1700048O20Rik A T 9: 121,940,703 noncoding transcript Het
2900011O08Rik T C 16: 14,095,939 *113R probably null Het
AA986860 A G 1: 130,743,825 R595G probably damaging Het
Acrbp C A 6: 125,054,796 F353L possibly damaging Het
Adamts20 T A 15: 94,353,571 Q445L probably benign Het
Adgrg5 A G 8: 94,933,508 D26G possibly damaging Het
Atad2b A T 12: 4,945,035 probably benign Het
Atg2a G T 19: 6,256,601 G1439C probably damaging Het
Atg2a G T 19: 6,256,602 G1439V probably benign Het
B3galt1 G A 2: 68,118,588 V216I probably benign Het
C2cd2 A G 16: 97,859,588 probably benign Het
Cacna2d1 G A 5: 16,359,027 V884M probably damaging Het
Cers5 C A 15: 99,745,914 C22F probably damaging Het
Ces1d C A 8: 93,197,679 C14F probably benign Het
Cntn3 G T 6: 102,203,966 P756Q probably damaging Het
Col5a3 A G 9: 20,782,481 probably null Het
Cox5b G A 1: 36,692,555 probably null Het
Cwc27 C A 13: 104,811,216 probably null Het
Cyp27b1 A C 10: 127,050,157 M260L probably benign Het
D11Wsu47e C T 11: 113,689,195 T472I possibly damaging Het
Ddx19b A T 8: 111,008,678 N465K probably benign Het
Depdc1b T C 13: 108,373,848 V298A probably benign Het
Dnaaf1 A G 8: 119,590,666 I311M possibly damaging Het
Dnah17 T C 11: 118,047,124 N3372S probably benign Het
Dus4l G A 12: 31,641,657 T184I possibly damaging Het
Dzip3 T C 16: 48,947,713 K453E possibly damaging Het
Fhod3 C T 18: 24,709,616 T3M probably damaging Het
Galnt10 T C 11: 57,781,222 L446P probably damaging Het
Gfod1 T A 13: 43,200,536 D321V possibly damaging Het
Glt8d2 C A 10: 82,662,153 probably benign Het
Gm11115 A G 5: 88,154,089 M4T unknown Het
Gm11568 G A 11: 99,858,383 C138Y unknown Het
Gm9742 A G 13: 8,035,016 noncoding transcript Het
Gnrhr G T 5: 86,197,575 T84N probably damaging Het
Gpr176 C A 2: 118,279,723 G352W probably damaging Het
Habp2 T C 19: 56,316,432 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j C G 11: 3,499,738 W681C probably damaging Het
Insl6 A G 19: 29,321,568 M148T probably benign Het
Itgb1 T G 8: 128,726,167 M771R possibly damaging Het
Kank1 G T 19: 25,425,993 probably benign Het
Kcnd3 T C 3: 105,459,626 Y271H probably damaging Het
Kcnq4 C A 4: 120,716,601 R221L probably damaging Het
Klk1b26 G A 7: 44,016,348 V195I probably benign Het
Lactb A C 9: 66,970,863 V228G possibly damaging Het
Ldb3 T C 14: 34,536,584 D649G probably damaging Het
Lilra6 T A 7: 3,913,139 R240S probably benign Het
Lrp2 A G 2: 69,507,801 Y1212H probably damaging Het
Mapk8ip1 A T 2: 92,385,976 probably null Het
Mctp1 C T 13: 76,827,727 L483F probably damaging Het
Mmp16 T C 4: 18,115,878 probably benign Het
Mphosph9 A T 5: 124,306,970 L360* probably null Het
Myh4 A G 11: 67,252,297 E1017G probably damaging Het
Nell1 A T 7: 50,230,180 M307L probably benign Het
Olfr1028 A G 2: 85,951,243 Y60C probably damaging Het
Olfr1082 A G 2: 86,594,408 V140A probably benign Het
Olfr119 C T 17: 37,701,297 A209V probably benign Het
Olfr959 A C 9: 39,572,843 C139G probably damaging Het
Phc2 A G 4: 128,723,307 probably benign Het
Pp2d1 C A 17: 53,507,971 C575F probably benign Het
Ptpra T A 2: 130,539,685 N364K probably damaging Het
R3hcc1l A G 19: 42,562,556 probably benign Het
Rims1 A G 1: 22,468,182 probably benign Het
Shank3 G A 15: 89,543,239 probably benign Het
Sit1 T A 4: 43,482,991 Q86L possibly damaging Het
Skint4 C A 4: 112,117,939 probably benign Het
Skint8 G T 4: 111,938,823 probably benign Het
Smim13 T C 13: 41,272,710 I74T probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Synpo2 T C 3: 123,114,332 D445G probably damaging Het
Tas2r102 A T 6: 132,762,365 I79F probably damaging Het
Thegl A G 5: 77,037,357 probably benign Het
Tmc4 A G 7: 3,667,610 L494P probably damaging Het
Togaram1 G T 12: 65,007,031 V1412F probably damaging Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trappc8 T A 18: 20,845,601 I813F possibly damaging Het
Trim26 T C 17: 36,852,706 probably benign Het
Unc13a T C 8: 71,644,913 D1171G probably damaging Het
Usp7 A G 16: 8,699,262 V245A probably damaging Het
Vmn1r38 T A 6: 66,776,995 T46S probably benign Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zcchc14 T A 8: 121,628,649 probably benign Het
Zfp451 T A 1: 33,770,910 probably benign Het
Other mutations in Col4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col4a1 APN 8 11240077 splice site probably benign
IGL00503:Col4a1 APN 8 11240076 splice site probably benign
IGL00938:Col4a1 APN 8 11236456 intron probably benign
IGL01295:Col4a1 APN 8 11236075 intron probably benign
IGL01406:Col4a1 APN 8 11218898 missense probably damaging 1.00
IGL01807:Col4a1 APN 8 11247056 utr 5 prime probably benign
IGL01865:Col4a1 APN 8 11201790 utr 3 prime probably benign
IGL02166:Col4a1 APN 8 11244509 unclassified probably benign
IGL02234:Col4a1 APN 8 11216713 missense probably damaging 1.00
IGL02445:Col4a1 APN 8 11233911 intron probably benign
IGL02719:Col4a1 APN 8 11231950 intron probably benign
IGL02817:Col4a1 APN 8 11220259 missense probably damaging 1.00
IGL02821:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02870:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02935:Col4a1 APN 8 11219166 missense probably damaging 1.00
IGL03085:Col4a1 APN 8 11222198 nonsense probably null
Wayne UTSW 8 11209650 missense probably damaging 1.00
IGL03134:Col4a1 UTSW 8 11240069 critical splice acceptor site probably null
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0238:Col4a1 UTSW 8 11218780 splice site probably benign
R0239:Col4a1 UTSW 8 11218780 splice site probably benign
R0268:Col4a1 UTSW 8 11267588 splice site probably benign
R0320:Col4a1 UTSW 8 11242782 splice site probably null
R0402:Col4a1 UTSW 8 11199838 utr 3 prime probably benign
R0511:Col4a1 UTSW 8 11208333 critical splice acceptor site probably null
R0544:Col4a1 UTSW 8 11226487 intron probably benign
R0630:Col4a1 UTSW 8 11199889 splice site probably benign
R0648:Col4a1 UTSW 8 11246892 missense unknown
R0733:Col4a1 UTSW 8 11218934 missense possibly damaging 0.46
R0839:Col4a1 UTSW 8 11221015 missense probably damaging 0.96
R0900:Col4a1 UTSW 8 11218014 small deletion probably benign
R0941:Col4a1 UTSW 8 11208296 missense unknown
R1456:Col4a1 UTSW 8 11242829 splice site probably benign
R1728:Col4a1 UTSW 8 11212712 missense possibly damaging 0.81
R1832:Col4a1 UTSW 8 11214644 splice site probably benign
R1862:Col4a1 UTSW 8 11226439 intron probably benign
R1955:Col4a1 UTSW 8 11208228 splice site probably null
R2058:Col4a1 UTSW 8 11210792 missense probably damaging 0.96
R2263:Col4a1 UTSW 8 11312586 unclassified probably benign
R2696:Col4a1 UTSW 8 11235092 splice site probably null
R3826:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3828:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3829:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3830:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3923:Col4a1 UTSW 8 11201665 utr 3 prime probably benign
R3980:Col4a1 UTSW 8 11239155 intron probably benign
R4120:Col4a1 UTSW 8 11206263 missense unknown
R4152:Col4a1 UTSW 8 11217227 intron probably null
R4437:Col4a1 UTSW 8 11206387 nonsense probably null
R5237:Col4a1 UTSW 8 11245068 unclassified probably benign
R5362:Col4a1 UTSW 8 11245760 unclassified probably benign
R5488:Col4a1 UTSW 8 11312550 unclassified probably benign
R5489:Col4a1 UTSW 8 11312550 unclassified probably benign
R5864:Col4a1 UTSW 8 11202973 utr 3 prime probably benign
R5929:Col4a1 UTSW 8 11216788 missense probably benign 0.17
R6159:Col4a1 UTSW 8 11220007 missense probably damaging 1.00
R6261:Col4a1 UTSW 8 11207409 splice site probably null
R6404:Col4a1 UTSW 8 11207409 splice site probably null
R6520:Col4a1 UTSW 8 11219152 missense probably damaging 1.00
R6862:Col4a1 UTSW 8 11202926 utr 3 prime probably benign
R6974:Col4a1 UTSW 8 11312538 unclassified probably benign
R7329:Col4a1 UTSW 8 11226494 critical splice acceptor site probably null
Z1088:Col4a1 UTSW 8 11246859 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGAGTCACCATCCTCAGGAAG -3'
(R):5'- CCGAACTGCCTGGCAATTCTACAC -3'

Sequencing Primer
(F):5'- CCATCCTCAGGAAGCTAGAGAG -3'
(R):5'- GCAATTCTACACTGAGTGGTTC -3'
Posted On2013-05-23