Incidental Mutation 'R0483:Myh4'
ID42138
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Namemyosin, heavy polypeptide 4, skeletal muscle
SynonymsMM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
MMRRC Submission 038683-MU
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R0483 (G1)
Quality Score216
Status Validated
Chromosome11
Chromosomal Location67238029-67260446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67252297 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1017 (E1017G)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
Predicted Effect probably damaging
Transcript: ENSMUST00000018632
AA Change: E1017G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: E1017G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170942
AA Change: E1017G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: E1017G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.472 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (89/90)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik G A 10: 83,759,638 probably benign Het
1700048O20Rik A T 9: 121,940,703 noncoding transcript Het
2900011O08Rik T C 16: 14,095,939 *113R probably null Het
AA986860 A G 1: 130,743,825 R595G probably damaging Het
Acrbp C A 6: 125,054,796 F353L possibly damaging Het
Adamts20 T A 15: 94,353,571 Q445L probably benign Het
Adgrg5 A G 8: 94,933,508 D26G possibly damaging Het
Atad2b A T 12: 4,945,035 probably benign Het
Atg2a G T 19: 6,256,601 G1439C probably damaging Het
Atg2a G T 19: 6,256,602 G1439V probably benign Het
B3galt1 G A 2: 68,118,588 V216I probably benign Het
C2cd2 A G 16: 97,859,588 probably benign Het
Cacna2d1 G A 5: 16,359,027 V884M probably damaging Het
Cers5 C A 15: 99,745,914 C22F probably damaging Het
Ces1d C A 8: 93,197,679 C14F probably benign Het
Cntn3 G T 6: 102,203,966 P756Q probably damaging Het
Col4a1 T C 8: 11,236,423 probably benign Het
Col5a3 A G 9: 20,782,481 probably null Het
Cox5b G A 1: 36,692,555 probably null Het
Cwc27 C A 13: 104,811,216 probably null Het
Cyp27b1 A C 10: 127,050,157 M260L probably benign Het
D11Wsu47e C T 11: 113,689,195 T472I possibly damaging Het
Ddx19b A T 8: 111,008,678 N465K probably benign Het
Depdc1b T C 13: 108,373,848 V298A probably benign Het
Dnaaf1 A G 8: 119,590,666 I311M possibly damaging Het
Dnah17 T C 11: 118,047,124 N3372S probably benign Het
Dus4l G A 12: 31,641,657 T184I possibly damaging Het
Dzip3 T C 16: 48,947,713 K453E possibly damaging Het
Fhod3 C T 18: 24,709,616 T3M probably damaging Het
Galnt10 T C 11: 57,781,222 L446P probably damaging Het
Gfod1 T A 13: 43,200,536 D321V possibly damaging Het
Glt8d2 C A 10: 82,662,153 probably benign Het
Gm11115 A G 5: 88,154,089 M4T unknown Het
Gm11568 G A 11: 99,858,383 C138Y unknown Het
Gm9742 A G 13: 8,035,016 noncoding transcript Het
Gnrhr G T 5: 86,197,575 T84N probably damaging Het
Gpr176 C A 2: 118,279,723 G352W probably damaging Het
Habp2 T C 19: 56,316,432 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j C G 11: 3,499,738 W681C probably damaging Het
Insl6 A G 19: 29,321,568 M148T probably benign Het
Itgb1 T G 8: 128,726,167 M771R possibly damaging Het
Kank1 G T 19: 25,425,993 probably benign Het
Kcnd3 T C 3: 105,459,626 Y271H probably damaging Het
Kcnq4 C A 4: 120,716,601 R221L probably damaging Het
Klk1b26 G A 7: 44,016,348 V195I probably benign Het
Lactb A C 9: 66,970,863 V228G possibly damaging Het
Ldb3 T C 14: 34,536,584 D649G probably damaging Het
Lilra6 T A 7: 3,913,139 R240S probably benign Het
Lrp2 A G 2: 69,507,801 Y1212H probably damaging Het
Mapk8ip1 A T 2: 92,385,976 probably null Het
Mctp1 C T 13: 76,827,727 L483F probably damaging Het
Mmp16 T C 4: 18,115,878 probably benign Het
Mphosph9 A T 5: 124,306,970 L360* probably null Het
Nell1 A T 7: 50,230,180 M307L probably benign Het
Olfr1028 A G 2: 85,951,243 Y60C probably damaging Het
Olfr1082 A G 2: 86,594,408 V140A probably benign Het
Olfr119 C T 17: 37,701,297 A209V probably benign Het
Olfr959 A C 9: 39,572,843 C139G probably damaging Het
Phc2 A G 4: 128,723,307 probably benign Het
Pp2d1 C A 17: 53,507,971 C575F probably benign Het
Ptpra T A 2: 130,539,685 N364K probably damaging Het
R3hcc1l A G 19: 42,562,556 probably benign Het
Rims1 A G 1: 22,468,182 probably benign Het
Shank3 G A 15: 89,543,239 probably benign Het
Sit1 T A 4: 43,482,991 Q86L possibly damaging Het
Skint4 C A 4: 112,117,939 probably benign Het
Skint8 G T 4: 111,938,823 probably benign Het
Smim13 T C 13: 41,272,710 I74T probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Synpo2 T C 3: 123,114,332 D445G probably damaging Het
Tas2r102 A T 6: 132,762,365 I79F probably damaging Het
Thegl A G 5: 77,037,357 probably benign Het
Tmc4 A G 7: 3,667,610 L494P probably damaging Het
Togaram1 G T 12: 65,007,031 V1412F probably damaging Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trappc8 T A 18: 20,845,601 I813F possibly damaging Het
Trim26 T C 17: 36,852,706 probably benign Het
Unc13a T C 8: 71,644,913 D1171G probably damaging Het
Usp7 A G 16: 8,699,262 V245A probably damaging Het
Vmn1r38 T A 6: 66,776,995 T46S probably benign Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zcchc14 T A 8: 121,628,649 probably benign Het
Zfp451 T A 1: 33,770,910 probably benign Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0346:Myh4 UTSW 11 67260326 missense probably benign
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1716:Myh4 UTSW 11 67250309 missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5011:Myh4 UTSW 11 67256363 missense probably benign 0.03
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6301:Myh4 UTSW 11 67255333 missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6666:Myh4 UTSW 11 67251812 missense probably damaging 1.00
R6826:Myh4 UTSW 11 67246531 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGACGACCTTGAGCTGACAC -3'
(R):5'- ACGAGGACTCTCAGCCTGCATTTC -3'

Sequencing Primer
(F):5'- GGTACAACCACTATTCACTTTCAAG -3'
(R):5'- AGCCTGCATTTCGAGGCTC -3'
Posted On2013-05-23