Incidental Mutation 'R5325:Fancg'
ID421876
Institutional Source Beutler Lab
Gene Symbol Fancg
Ensembl Gene ENSMUSG00000028453
Gene NameFanconi anemia, complementation group G
SynonymsXrcc9
MMRRC Submission 042908-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43002343-43010506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43006564 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 330 (V330A)
Ref Sequence ENSEMBL: ENSMUSP00000030165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030165]
Predicted Effect probably damaging
Transcript: ENSMUST00000030165
AA Change: V330A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030165
Gene: ENSMUSG00000028453
AA Change: V330A

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Pfam:TPR_1 251 280 4.1e-6 PFAM
Pfam:TPR_2 251 281 7.3e-5 PFAM
Pfam:TPR_8 251 281 4.5e-3 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Blast:TPR 458 491 4e-9 BLAST
Blast:TPR 518 550 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148018
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females and males homozygous for targeted null mutations exhibit hypogonadism and reduced fertility. Cytogeneic analysis showed somatic chromosome aberrations occur at a higher spontaneous rate and are easier to induce than in normal cells. Cells are also more sensitive to mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fbxo30 G A 10: 11,291,102 V523I possibly damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Gpr63 T C 4: 25,007,294 V6A probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nr2e1 G A 10: 42,572,784 R153W probably damaging Het
Nudt9 A C 5: 104,050,621 M1L possibly damaging Het
Odf2 T A 2: 29,912,571 D282E probably benign Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Sytl1 T C 4: 133,261,071 probably benign Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Zfp956 T C 6: 47,951,078 probably benign Het
Other mutations in Fancg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Fancg APN 4 43003910 nonsense probably null
IGL02072:Fancg APN 4 43007062 missense probably benign 0.00
IGL02184:Fancg APN 4 43006872 missense possibly damaging 0.79
IGL02989:Fancg APN 4 43007121 splice site probably benign
R0671:Fancg UTSW 4 43002998 missense probably benign 0.00
R1581:Fancg UTSW 4 43007039 missense probably damaging 1.00
R1853:Fancg UTSW 4 43009727 missense probably benign 0.00
R2046:Fancg UTSW 4 43004604 missense probably damaging 1.00
R2519:Fancg UTSW 4 43008787 missense probably damaging 1.00
R4282:Fancg UTSW 4 43003830 missense probably damaging 1.00
R4397:Fancg UTSW 4 43008897 missense probably benign 0.02
R4583:Fancg UTSW 4 43002991 missense probably benign
R4671:Fancg UTSW 4 43005272 missense probably benign 0.01
R4887:Fancg UTSW 4 43006866 missense probably benign 0.18
R5309:Fancg UTSW 4 43003019 missense probably benign 0.23
R5312:Fancg UTSW 4 43003019 missense probably benign 0.23
R5379:Fancg UTSW 4 43002998 missense probably benign 0.00
R5386:Fancg UTSW 4 43007076 nonsense probably null
R5649:Fancg UTSW 4 43008736 missense probably damaging 1.00
R5788:Fancg UTSW 4 43007130 intron probably benign
R5802:Fancg UTSW 4 43006582 missense probably benign
R6217:Fancg UTSW 4 43010084 missense probably benign 0.03
R6698:Fancg UTSW 4 43007034 missense probably benign 0.00
R7092:Fancg UTSW 4 43004831 missense probably benign 0.03
R7527:Fancg UTSW 4 43010116 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCACATGTCCAGTGAAAGC -3'
(R):5'- GAGGCTTCCAGAGTATATAGGC -3'

Sequencing Primer
(F):5'- CATGTCCAGTGAAAGCATCAG -3'
(R):5'- TGGGTGTGGTTCACAAAG -3'
Posted On2016-08-04