Incidental Mutation 'R5325:Sytl1'
ID421878
Institutional Source Beutler Lab
Gene Symbol Sytl1
Ensembl Gene ENSMUSG00000028860
Gene Namesynaptotagmin-like 1
SynonymsPSGL-1, Slp1
MMRRC Submission 042908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133253090-133263113 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 133261071 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000105907] [ENSMUST00000105908]
Predicted Effect probably benign
Transcript: ENSMUST00000030674
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105907
SMART Domains Protein: ENSMUSP00000101527
Gene: ENSMUSG00000028857

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:DUF778 61 118 4.4e-28 PFAM
Pfam:DUF778 112 178 3.2e-22 PFAM
transmembrane domain 188 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105908
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154911
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased number of acinar zygomen granules in a fasted state that can be released by strong stimuli of the fed state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fancg A G 4: 43,006,564 V330A probably damaging Het
Fbxo30 G A 10: 11,291,102 V523I possibly damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Gpr63 T C 4: 25,007,294 V6A probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nr2e1 G A 10: 42,572,784 R153W probably damaging Het
Nudt9 A C 5: 104,050,621 M1L possibly damaging Het
Odf2 T A 2: 29,912,571 D282E probably benign Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Zfp956 T C 6: 47,951,078 probably benign Het
Other mutations in Sytl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sytl1 APN 4 133258856 splice site probably null
IGL02693:Sytl1 APN 4 133257746 missense probably benign 0.03
IGL02721:Sytl1 APN 4 133258878 missense probably benign 0.25
IGL02975:Sytl1 APN 4 133261032 missense probably benign 0.05
FR4304:Sytl1 UTSW 4 133256993 small deletion probably benign
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0677:Sytl1 UTSW 4 133253225 missense possibly damaging 0.89
R1135:Sytl1 UTSW 4 133256970 missense probably damaging 1.00
R1269:Sytl1 UTSW 4 133256115 missense probably damaging 1.00
R2018:Sytl1 UTSW 4 133256160 missense probably damaging 0.99
R2106:Sytl1 UTSW 4 133257463 missense probably benign 0.00
R3938:Sytl1 UTSW 4 133255624 nonsense probably null
R4210:Sytl1 UTSW 4 133253565 missense probably damaging 1.00
R4970:Sytl1 UTSW 4 133255582 nonsense probably null
R5027:Sytl1 UTSW 4 133256219 intron probably benign
R5557:Sytl1 UTSW 4 133259356 missense probably damaging 1.00
R6310:Sytl1 UTSW 4 133260998 missense probably benign 0.34
T0722:Sytl1 UTSW 4 133256851 splice site probably benign
T0722:Sytl1 UTSW 4 133256853 splice site probably benign
T0975:Sytl1 UTSW 4 133256994 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGAGATGGCCTCCTGTTC -3'
(R):5'- ATCAGCGTGTACTGTCTTGC -3'

Sequencing Primer
(F):5'- CCTGTTCCTCCTCTGTCAGG -3'
(R):5'- CATCCTTAGGAGCATGCGCATATG -3'
Posted On2016-08-04