Incidental Mutation 'R5325:Zfp956'
ID421885
Institutional Source Beutler Lab
Gene Symbol Zfp956
Ensembl Gene ENSMUSG00000045466
Gene Namezinc finger protein 956
SynonymsAI894139
MMRRC Submission 042908-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47953390-47965300 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 47951078 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101445] [ENSMUST00000140719]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095946
Predicted Effect probably benign
Transcript: ENSMUST00000101445
SMART Domains Protein: ENSMUSP00000098989
Gene: ENSMUSG00000045466

DomainStartEndE-ValueType
Pfam:DUF3669 39 99 2.1e-9 PFAM
KRAB 129 191 2.4e-1 SMART
ZnF_C2H2 325 347 2.24e-3 SMART
ZnF_C2H2 353 375 2.09e-3 SMART
ZnF_C2H2 381 403 6.78e-3 SMART
ZnF_C2H2 409 431 2.57e-3 SMART
ZnF_C2H2 437 459 3.16e-3 SMART
ZnF_C2H2 465 487 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135828
Predicted Effect probably benign
Transcript: ENSMUST00000140719
SMART Domains Protein: ENSMUSP00000114227
Gene: ENSMUSG00000045466

DomainStartEndE-ValueType
Pfam:DUF3669 22 101 2.4e-16 PFAM
Blast:KRAB 129 179 2e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212438
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fancg A G 4: 43,006,564 V330A probably damaging Het
Fbxo30 G A 10: 11,291,102 V523I possibly damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Gpr63 T C 4: 25,007,294 V6A probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nr2e1 G A 10: 42,572,784 R153W probably damaging Het
Nudt9 A C 5: 104,050,621 M1L possibly damaging Het
Odf2 T A 2: 29,912,571 D282E probably benign Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Sytl1 T C 4: 133,261,071 probably benign Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Other mutations in Zfp956
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Zfp956 APN 6 47963412 missense probably benign 0.28
ANU74:Zfp956 UTSW 6 47963573 missense probably benign 0.00
R0603:Zfp956 UTSW 6 47956028 missense probably damaging 1.00
R1243:Zfp956 UTSW 6 47956051 missense probably damaging 0.98
R1879:Zfp956 UTSW 6 47963744 missense probably benign 0.19
R1999:Zfp956 UTSW 6 47963871 missense probably damaging 1.00
R2106:Zfp956 UTSW 6 47964425 makesense probably null
R2150:Zfp956 UTSW 6 47963871 missense probably damaging 1.00
R4737:Zfp956 UTSW 6 47962542 missense probably damaging 0.99
R4740:Zfp956 UTSW 6 47962542 missense probably damaging 0.99
R4751:Zfp956 UTSW 6 47963576 missense probably benign 0.00
R4832:Zfp956 UTSW 6 47952053 unclassified probably benign
R5523:Zfp956 UTSW 6 47953521 start gained probably benign
R6842:Zfp956 UTSW 6 47963829 missense possibly damaging 0.47
R7131:Zfp956 UTSW 6 47955847 missense not run
Predicted Primers PCR Primer
(F):5'- CTCTTAATTTTGGTCTGGAAGCAG -3'
(R):5'- TTACTCCAGGTTCAGGCCTC -3'

Sequencing Primer
(F):5'- AGTTGGCACTCATGGGCTC -3'
(R):5'- TGAGTGCCATTAGATCAGGCC -3'
Posted On2016-08-04