Incidental Mutation 'R5325:Fbxo30'
ID421899
Institutional Source Beutler Lab
Gene Symbol Fbxo30
Ensembl Gene ENSMUSG00000047648
Gene NameF-box protein 30
SynonymsFbx30
MMRRC Submission 042908-MU
Accession Numbers

Ncbi RefSeq: NM_027968.3, NM_001168297.1; MGI: 1919115

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location11281330-11298052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11291102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 523 (V523I)
Ref Sequence ENSEMBL: ENSMUSP00000117687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070300] [ENSMUST00000129456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070300
AA Change: V523I

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068230
Gene: ENSMUSG00000047648
AA Change: V523I

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 8 100 2.5e-42 PFAM
Pfam:F-box_4 610 725 1.6e-52 PFAM
Pfam:F-box 612 653 3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129456
AA Change: V523I

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117687
Gene: ENSMUSG00000047648
AA Change: V523I

DomainStartEndE-ValueType
PDB:2YRE|A 1 88 6e-51 PDB
SCOP:d1k2fa_ 58 93 7e-3 SMART
Pfam:F-box 612 653 2.3e-7 PFAM
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fancg A G 4: 43,006,564 V330A probably damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Gpr63 T C 4: 25,007,294 V6A probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nr2e1 G A 10: 42,572,784 R153W probably damaging Het
Nudt9 A C 5: 104,050,621 M1L possibly damaging Het
Odf2 T A 2: 29,912,571 D282E probably benign Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Sytl1 T C 4: 133,261,071 probably benign Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Zfp956 T C 6: 47,951,078 probably benign Het
Other mutations in Fbxo30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Fbxo30 APN 10 11290539 missense probably benign 0.01
IGL00971:Fbxo30 APN 10 11290298 missense probably benign
IGL02388:Fbxo30 APN 10 11290378 missense probably benign 0.01
PIT4468001:Fbxo30 UTSW 10 11290956 missense possibly damaging 0.95
R0014:Fbxo30 UTSW 10 11289859 nonsense probably null
R0144:Fbxo30 UTSW 10 11295220 missense probably damaging 1.00
R0709:Fbxo30 UTSW 10 11291313 missense possibly damaging 0.79
R1583:Fbxo30 UTSW 10 11291374 missense possibly damaging 0.67
R1791:Fbxo30 UTSW 10 11289787 nonsense probably null
R2018:Fbxo30 UTSW 10 11291028 missense probably damaging 0.98
R2317:Fbxo30 UTSW 10 11290334 missense probably damaging 0.98
R3842:Fbxo30 UTSW 10 11290112 missense probably damaging 0.98
R4579:Fbxo30 UTSW 10 11289549 missense probably benign 0.00
R4655:Fbxo30 UTSW 10 11291093 missense probably damaging 1.00
R4751:Fbxo30 UTSW 10 11290195 missense probably benign 0.01
R4998:Fbxo30 UTSW 10 11290763 missense probably damaging 0.98
R5463:Fbxo30 UTSW 10 11291069 missense probably damaging 1.00
R5534:Fbxo30 UTSW 10 11289665 missense possibly damaging 0.91
R5594:Fbxo30 UTSW 10 11290479 missense probably benign 0.13
R5757:Fbxo30 UTSW 10 11290421 missense probably benign 0.08
R5917:Fbxo30 UTSW 10 11289518 critical splice acceptor site probably null
R6232:Fbxo30 UTSW 10 11289858 missense possibly damaging 0.90
R6472:Fbxo30 UTSW 10 11291231 missense probably damaging 1.00
R6677:Fbxo30 UTSW 10 11290636 missense possibly damaging 0.61
R6802:Fbxo30 UTSW 10 11291480 missense probably damaging 1.00
R7128:Fbxo30 UTSW 10 11290116 nonsense probably null
X0012:Fbxo30 UTSW 10 11290466 missense probably benign 0.00
X0066:Fbxo30 UTSW 10 11290812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCACGTTGACTTTGGGACAC -3'
(R):5'- ACTCCAAATGACCTTAAATGGCG -3'

Sequencing Primer
(F):5'- GACTTTGGGACACAGACTTTTTCAC -3'
(R):5'- CCAAATGACCTTAAATGGCGATCATG -3'
Posted On2016-08-04