Incidental Mutation 'R5326:Angpt4'
ID421932
Institutional Source Beutler Lab
Gene Symbol Angpt4
Ensembl Gene ENSMUSG00000027460
Gene Nameangiopoietin 4
Synonyms
MMRRC Submission 042909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5326 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location151911210-151945337 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 151925544 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028955]
Predicted Effect probably null
Transcript: ENSMUST00000028955
SMART Domains Protein: ENSMUSP00000028955
Gene: ENSMUSG00000027460

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
coiled coil region 181 239 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
FBG 292 507 2.23e-98 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the angiopoietin family of secreted growth factors comprising Angiopoietins-1, -2, and -3, all of which bind the TEK Receptor Tyrosine Kinase. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is involved in survival and migration of endothelial cells and regulates vascular remodeling and maintenance of vascular integrity. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is also required for lymphangiogenesis. Family members bind TEK Receptor Tyrosine Kinase as multimeric clusters but their oligomerization properties differ from one another and this is thought to provide a mechanistic basis for their distinct physiologic roles. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,354 T127A probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Actl6b T C 5: 137,567,051 S366P probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Adgrf5 T A 17: 43,440,074 I510N probably damaging Het
Adra2a A G 19: 54,046,681 Y156C probably damaging Het
Ankdd1a T A 9: 65,504,190 probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Brd3 A G 2: 27,450,544 L551P probably benign Het
Calb2 C T 8: 110,156,978 G38D possibly damaging Het
Cand1 G A 10: 119,212,028 A519V probably benign Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Cog6 T A 3: 53,013,816 Q123L probably null Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Depdc1a T C 3: 159,526,649 V679A probably damaging Het
Dyrk1a A G 16: 94,686,581 D512G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Frs2 T C 10: 117,077,563 S121G probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Ggt1 T C 10: 75,585,706 probably null Het
Gigyf2 T C 1: 87,425,138 probably benign Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm9476 T A 10: 100,307,134 noncoding transcript Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Gmcl1 A T 6: 86,726,145 N102K possibly damaging Het
Gml T C 15: 74,816,450 N56S probably damaging Het
Gpam A C 19: 55,091,165 S128R probably benign Het
Gucy1b2 C T 14: 62,453,330 probably null Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hmx3 C T 7: 131,544,417 Q285* probably null Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighv5-17 T C 12: 113,859,258 D81G possibly damaging Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Iqcd A G 5: 120,602,375 Q257R probably damaging Het
Itpk1 T C 12: 102,573,966 N286S possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Knop1 T C 7: 118,853,272 K23E possibly damaging Het
Ksr2 T A 5: 117,708,240 V724E probably damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Morc2b T A 17: 33,136,933 T622S probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtmr2 A G 9: 13,788,647 Y38C probably damaging Het
Mycbpap A T 11: 94,507,746 probably null Het
Nadsyn1 T A 7: 143,808,830 R279W probably benign Het
Olfr1354 G A 10: 78,917,586 V249I possibly damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr689 T A 7: 105,314,439 F145Y probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Prkar1b T C 5: 139,127,789 probably null Het
Ric8b T C 10: 84,992,212 Y467H probably damaging Het
Rin1 A G 19: 5,052,624 E387G probably damaging Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Seh1l C T 18: 67,774,999 probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Snrnp70 GCGGTCCCGGTCCCGGTC GCGGTCCCGGTC 7: 45,377,233 probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Spin1 A G 13: 51,139,527 Y91C probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trim30c T A 7: 104,388,304 M152L possibly damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Wdr11 T C 7: 129,625,249 S812P probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zdbf2 T G 1: 63,304,411 C650G possibly damaging Het
Zfp282 T A 6: 47,905,327 N649K probably benign Het
Other mutations in Angpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Angpt4 APN 2 151911471 missense probably damaging 0.99
IGL03107:Angpt4 APN 2 151943422 missense probably benign 0.08
IGL03343:Angpt4 APN 2 151936703 missense probably damaging 1.00
R0034:Angpt4 UTSW 2 151929391 missense probably benign 0.44
R0709:Angpt4 UTSW 2 151934514 missense possibly damaging 0.46
R0764:Angpt4 UTSW 2 151911284 start gained probably benign
R0853:Angpt4 UTSW 2 151938927 missense probably damaging 1.00
R1796:Angpt4 UTSW 2 151938989 missense probably damaging 1.00
R2091:Angpt4 UTSW 2 151936783 splice site probably benign
R2184:Angpt4 UTSW 2 151938954 missense probably damaging 1.00
R2901:Angpt4 UTSW 2 151911339 missense unknown
R3014:Angpt4 UTSW 2 151929597 missense probably benign 0.07
R4192:Angpt4 UTSW 2 151943318 missense probably benign
R4440:Angpt4 UTSW 2 151944646 missense probably damaging 1.00
R5059:Angpt4 UTSW 2 151934440 missense probably damaging 1.00
R6345:Angpt4 UTSW 2 151929434 missense probably benign 0.00
R7232:Angpt4 UTSW 2 151929540 missense possibly damaging 0.63
R7313:Angpt4 UTSW 2 151925406 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCATGGGAAGGAGCCACAG -3'
(R):5'- CACACAGGAGGGATTGTTCC -3'

Sequencing Primer
(F):5'- ACAGGAGGCTTCATCCCC -3'
(R):5'- GAGGGATTGTTCCTTCCTTGTCC -3'
Posted On2016-08-04