Incidental Mutation 'R5326:Ksr2'
ID421947
Institutional Source Beutler Lab
Gene Symbol Ksr2
Ensembl Gene ENSMUSG00000061578
Gene Namekinase suppressor of ras 2
Synonyms
MMRRC Submission 042909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5326 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117414000-117775003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117708240 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 724 (V724E)
Ref Sequence ENSEMBL: ENSMUSP00000137670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180430]
Predicted Effect probably damaging
Transcript: ENSMUST00000180430
AA Change: V724E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137670
Gene: ENSMUSG00000061578
AA Change: V724E

DomainStartEndE-ValueType
Pfam:KSR1-SAM 24 152 1.1e-45 PFAM
low complexity region 258 282 N/A INTRINSIC
low complexity region 326 341 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
C1 412 457 2.74e-8 SMART
low complexity region 518 551 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
Pfam:Pkinase 667 929 1.1e-41 PFAM
Pfam:Pkinase_Tyr 667 929 1.8e-46 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit increased body fat and obesity, resulting from hyperphagia. Mice are also glucose intolerant and have high serum cholesterol, ALT, serum lipids and show hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,354 T127A probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Actl6b T C 5: 137,567,051 S366P probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Adgrf5 T A 17: 43,440,074 I510N probably damaging Het
Adra2a A G 19: 54,046,681 Y156C probably damaging Het
Angpt4 T C 2: 151,925,544 probably null Het
Ankdd1a T A 9: 65,504,190 probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Brd3 A G 2: 27,450,544 L551P probably benign Het
Calb2 C T 8: 110,156,978 G38D possibly damaging Het
Cand1 G A 10: 119,212,028 A519V probably benign Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Cog6 T A 3: 53,013,816 Q123L probably null Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Depdc1a T C 3: 159,526,649 V679A probably damaging Het
Dyrk1a A G 16: 94,686,581 D512G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Frs2 T C 10: 117,077,563 S121G probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Ggt1 T C 10: 75,585,706 probably null Het
Gigyf2 T C 1: 87,425,138 probably benign Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm9476 T A 10: 100,307,134 noncoding transcript Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Gmcl1 A T 6: 86,726,145 N102K possibly damaging Het
Gml T C 15: 74,816,450 N56S probably damaging Het
Gpam A C 19: 55,091,165 S128R probably benign Het
Gucy1b2 C T 14: 62,453,330 probably null Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hmx3 C T 7: 131,544,417 Q285* probably null Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighv5-17 T C 12: 113,859,258 D81G possibly damaging Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Iqcd A G 5: 120,602,375 Q257R probably damaging Het
Itpk1 T C 12: 102,573,966 N286S possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Knop1 T C 7: 118,853,272 K23E possibly damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Morc2b T A 17: 33,136,933 T622S probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtmr2 A G 9: 13,788,647 Y38C probably damaging Het
Mycbpap A T 11: 94,507,746 probably null Het
Nadsyn1 T A 7: 143,808,830 R279W probably benign Het
Olfr1354 G A 10: 78,917,586 V249I possibly damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr689 T A 7: 105,314,439 F145Y probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Prkar1b T C 5: 139,127,789 probably null Het
Ric8b T C 10: 84,992,212 Y467H probably damaging Het
Rin1 A G 19: 5,052,624 E387G probably damaging Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Seh1l C T 18: 67,774,999 probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Snrnp70 GCGGTCCCGGTCCCGGTC GCGGTCCCGGTC 7: 45,377,233 probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Spin1 A G 13: 51,139,527 Y91C probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trim30c T A 7: 104,388,304 M152L possibly damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Wdr11 T C 7: 129,625,249 S812P probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zdbf2 T G 1: 63,304,411 C650G possibly damaging Het
Zfp282 T A 6: 47,905,327 N649K probably benign Het
Other mutations in Ksr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Ksr2 APN 5 117616894 missense possibly damaging 0.52
IGL02231:Ksr2 APN 5 117500776 missense probably damaging 1.00
IGL02634:Ksr2 APN 5 117763329 splice site probably benign
IGL02669:Ksr2 APN 5 117555381 missense probably damaging 1.00
IGL03116:Ksr2 APN 5 117707957 missense probably benign 0.20
IGL03168:Ksr2 APN 5 117748781 missense probably damaging 1.00
IGL03372:Ksr2 APN 5 117702718 missense possibly damaging 0.93
gigante UTSW 5 117671449 missense probably damaging 0.99
R0133:Ksr2 UTSW 5 117555294 missense possibly damaging 0.95
R0811:Ksr2 UTSW 5 117555225 missense probably damaging 1.00
R0812:Ksr2 UTSW 5 117555225 missense probably damaging 1.00
R1162:Ksr2 UTSW 5 117554955 splice site probably benign
R1420:Ksr2 UTSW 5 117414839 missense probably benign 0.10
R1717:Ksr2 UTSW 5 117671449 missense probably damaging 0.99
R1809:Ksr2 UTSW 5 117555470 missense probably damaging 1.00
R1859:Ksr2 UTSW 5 117414941 missense probably damaging 1.00
R1867:Ksr2 UTSW 5 117505529 missense probably benign 0.32
R1868:Ksr2 UTSW 5 117505529 missense probably benign 0.32
R3024:Ksr2 UTSW 5 117555060 missense possibly damaging 0.52
R3499:Ksr2 UTSW 5 117689575 missense probably damaging 1.00
R3687:Ksr2 UTSW 5 117554979 missense probably damaging 0.98
R3688:Ksr2 UTSW 5 117554979 missense probably damaging 0.98
R4044:Ksr2 UTSW 5 117555062 nonsense probably null
R4579:Ksr2 UTSW 5 117756270 missense probably damaging 0.99
R4697:Ksr2 UTSW 5 117708147 missense probably damaging 1.00
R4834:Ksr2 UTSW 5 117668327 missense probably benign 0.37
R5016:Ksr2 UTSW 5 117500792 missense probably benign 0.10
R5107:Ksr2 UTSW 5 117689608 missense probably benign 0.01
R5150:Ksr2 UTSW 5 117555009 missense probably damaging 0.97
R5493:Ksr2 UTSW 5 117708110 missense probably damaging 1.00
R5738:Ksr2 UTSW 5 117748799 missense probably damaging 0.97
R6257:Ksr2 UTSW 5 117414844 missense probably benign 0.01
R6316:Ksr2 UTSW 5 117685502 missense probably damaging 1.00
R6389:Ksr2 UTSW 5 117414842 missense probably benign 0.09
R6460:Ksr2 UTSW 5 117756384 critical splice donor site probably null
R6874:Ksr2 UTSW 5 117756336 nonsense probably null
R6939:Ksr2 UTSW 5 117765561 makesense probably null
Z1088:Ksr2 UTSW 5 117747402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTTGAACAGCTAGAGATTGG -3'
(R):5'- GGCTTTTCTGGCTCCCAATG -3'

Sequencing Primer
(F):5'- CTAGAGATTGGCGAGCTCATC -3'
(R):5'- CTGGCTCCCAATGCAGTAC -3'
Posted On2016-08-04