Incidental Mutation 'R5326:Trim30c'
ID421962
Institutional Source Beutler Lab
Gene Symbol Trim30c
Ensembl Gene ENSMUSG00000078616
Gene Nametripartite motif-containing 30C
SynonymsGm5598, Trim30-2
MMRRC Submission 042909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5326 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104382065-104400837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104388304 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 152 (M152L)
Ref Sequence ENSEMBL: ENSMUSP00000102441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106828
AA Change: M152L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102441
Gene: ENSMUSG00000078616
AA Change: M152L

DomainStartEndE-ValueType
RING 16 59 2.51e-10 SMART
BBOX 92 133 2.02e-14 SMART
low complexity region 197 229 N/A INTRINSIC
Pfam:SPRY 356 495 1.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,354 T127A probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Actl6b T C 5: 137,567,051 S366P probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Adgrf5 T A 17: 43,440,074 I510N probably damaging Het
Adra2a A G 19: 54,046,681 Y156C probably damaging Het
Angpt4 T C 2: 151,925,544 probably null Het
Ankdd1a T A 9: 65,504,190 probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Brd3 A G 2: 27,450,544 L551P probably benign Het
Calb2 C T 8: 110,156,978 G38D possibly damaging Het
Cand1 G A 10: 119,212,028 A519V probably benign Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Cog6 T A 3: 53,013,816 Q123L probably null Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Depdc1a T C 3: 159,526,649 V679A probably damaging Het
Dyrk1a A G 16: 94,686,581 D512G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Frs2 T C 10: 117,077,563 S121G probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Ggt1 T C 10: 75,585,706 probably null Het
Gigyf2 T C 1: 87,425,138 probably benign Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm9476 T A 10: 100,307,134 noncoding transcript Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Gmcl1 A T 6: 86,726,145 N102K possibly damaging Het
Gml T C 15: 74,816,450 N56S probably damaging Het
Gpam A C 19: 55,091,165 S128R probably benign Het
Gucy1b2 C T 14: 62,453,330 probably null Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hmx3 C T 7: 131,544,417 Q285* probably null Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighv5-17 T C 12: 113,859,258 D81G possibly damaging Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Iqcd A G 5: 120,602,375 Q257R probably damaging Het
Itpk1 T C 12: 102,573,966 N286S possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Knop1 T C 7: 118,853,272 K23E possibly damaging Het
Ksr2 T A 5: 117,708,240 V724E probably damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Morc2b T A 17: 33,136,933 T622S probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtmr2 A G 9: 13,788,647 Y38C probably damaging Het
Mycbpap A T 11: 94,507,746 probably null Het
Nadsyn1 T A 7: 143,808,830 R279W probably benign Het
Olfr1354 G A 10: 78,917,586 V249I possibly damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr689 T A 7: 105,314,439 F145Y probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Prkar1b T C 5: 139,127,789 probably null Het
Ric8b T C 10: 84,992,212 Y467H probably damaging Het
Rin1 A G 19: 5,052,624 E387G probably damaging Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Seh1l C T 18: 67,774,999 probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Snrnp70 GCGGTCCCGGTCCCGGTC GCGGTCCCGGTC 7: 45,377,233 probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Spin1 A G 13: 51,139,527 Y91C probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Wdr11 T C 7: 129,625,249 S812P probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zdbf2 T G 1: 63,304,411 C650G possibly damaging Het
Zfp282 T A 6: 47,905,327 N649K probably benign Het
Other mutations in Trim30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Trim30c APN 7 104382182 nonsense probably null
IGL00573:Trim30c APN 7 104382631 missense possibly damaging 0.66
IGL01023:Trim30c APN 7 104382972 splice site probably benign
IGL01413:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL01418:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL02330:Trim30c APN 7 104382958 missense possibly damaging 0.61
IGL02389:Trim30c APN 7 104382174 missense probably benign 0.00
IGL03107:Trim30c APN 7 104382613 missense possibly damaging 0.95
R0195:Trim30c UTSW 7 104382429 missense probably benign
R0324:Trim30c UTSW 7 104383309 missense possibly damaging 0.79
R0826:Trim30c UTSW 7 104383481 missense probably benign 0.01
R0865:Trim30c UTSW 7 104390451 missense probably damaging 1.00
R1484:Trim30c UTSW 7 104383252 missense probably benign 0.00
R1513:Trim30c UTSW 7 104382689 missense probably benign 0.04
R1563:Trim30c UTSW 7 104382951 missense probably benign 0.00
R2220:Trim30c UTSW 7 104383267 missense probably benign
R2442:Trim30c UTSW 7 104382274 missense probably damaging 1.00
R5777:Trim30c UTSW 7 104383331 missense probably benign 0.08
R6118:Trim30c UTSW 7 104382081 missense probably benign 0.01
R6257:Trim30c UTSW 7 104390168 missense probably damaging 1.00
R6374:Trim30c UTSW 7 104390402 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGACCAAGCATCCTCCATG -3'
(R):5'- AAACAGGCCCAGTTCTCTG -3'

Sequencing Primer
(F):5'- GTGTGATACACTGACTCTGCATC -3'
(R):5'- CCAGTTCTCTGATGCTGGATACAAAG -3'
Posted On2016-08-04