Incidental Mutation 'R5326:Ggt1'
ID421973
Institutional Source Beutler Lab
Gene Symbol Ggt1
Ensembl Gene ENSMUSG00000006345
Gene Namegamma-glutamyltransferase 1
SynonymsGgtp, CD224, GGT, dwg
MMRRC Submission 042909-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R5326 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75561604-75586200 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 75585706 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006508] [ENSMUST00000072217] [ENSMUST00000134503] [ENSMUST00000189972] [ENSMUST00000218807]
Predicted Effect probably null
Transcript: ENSMUST00000006508
SMART Domains Protein: ENSMUSP00000006508
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 4.9e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000044101
Predicted Effect probably benign
Transcript: ENSMUST00000072217
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129020
SMART Domains Protein: ENSMUSP00000118825
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 263 3.3e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134503
SMART Domains Protein: ENSMUSP00000121312
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 1.4e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148447
Predicted Effect probably null
Transcript: ENSMUST00000155186
SMART Domains Protein: ENSMUSP00000123017
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 128 6.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156487
Predicted Effect probably benign
Transcript: ENSMUST00000189972
SMART Domains Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189991
Predicted Effect probably benign
Transcript: ENSMUST00000218807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219247
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes gamma-glutamyl transpeptidase, a plasmamembrane-associated enzyme that cleaves the peptide bond between gamma-glutamyl and cysteinyl glycine moieties of glutathione. The encoded protein is autocatalytically processed to generate an enzymatically active heterodimer comprised of heavy and light chains. Mice lacking the encoded protein grow slowly, develop cataracts and have elevated levels of glutathione in plasma and urine. Transgenic overexpression of the encoded protein in mice enhances osteoclastic bone resorption. The mutant alleles termed 'Dwarf grey' and 'Dwarf grey Bayer' in mice are associated with deletions in this gene. A gamma-glutamyl transpeptidase paralog is located adjacent to this gene. Alternative splicing results in multiple transcript variants. Additional transcripts using alternate promoters and differing in 5' UTRs have been described. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutants may exhibit impaired growth, skeletal abnormalities, cataracts, lethargic behavior, premature greying, sterility, and shortened life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,354 T127A probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Actl6b T C 5: 137,567,051 S366P probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Adgrf5 T A 17: 43,440,074 I510N probably damaging Het
Adra2a A G 19: 54,046,681 Y156C probably damaging Het
Angpt4 T C 2: 151,925,544 probably null Het
Ankdd1a T A 9: 65,504,190 probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Brd3 A G 2: 27,450,544 L551P probably benign Het
Calb2 C T 8: 110,156,978 G38D possibly damaging Het
Cand1 G A 10: 119,212,028 A519V probably benign Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Cog6 T A 3: 53,013,816 Q123L probably null Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Depdc1a T C 3: 159,526,649 V679A probably damaging Het
Dyrk1a A G 16: 94,686,581 D512G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Frs2 T C 10: 117,077,563 S121G probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Gigyf2 T C 1: 87,425,138 probably benign Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm9476 T A 10: 100,307,134 noncoding transcript Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Gmcl1 A T 6: 86,726,145 N102K possibly damaging Het
Gml T C 15: 74,816,450 N56S probably damaging Het
Gpam A C 19: 55,091,165 S128R probably benign Het
Gucy1b2 C T 14: 62,453,330 probably null Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hmx3 C T 7: 131,544,417 Q285* probably null Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighv5-17 T C 12: 113,859,258 D81G possibly damaging Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Iqcd A G 5: 120,602,375 Q257R probably damaging Het
Itpk1 T C 12: 102,573,966 N286S possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Knop1 T C 7: 118,853,272 K23E possibly damaging Het
Ksr2 T A 5: 117,708,240 V724E probably damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Morc2b T A 17: 33,136,933 T622S probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtmr2 A G 9: 13,788,647 Y38C probably damaging Het
Mycbpap A T 11: 94,507,746 probably null Het
Nadsyn1 T A 7: 143,808,830 R279W probably benign Het
Olfr1354 G A 10: 78,917,586 V249I possibly damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr689 T A 7: 105,314,439 F145Y probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Prkar1b T C 5: 139,127,789 probably null Het
Ric8b T C 10: 84,992,212 Y467H probably damaging Het
Rin1 A G 19: 5,052,624 E387G probably damaging Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Seh1l C T 18: 67,774,999 probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Snrnp70 GCGGTCCCGGTCCCGGTC GCGGTCCCGGTC 7: 45,377,233 probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Spin1 A G 13: 51,139,527 Y91C probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trim30c T A 7: 104,388,304 M152L possibly damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Wdr11 T C 7: 129,625,249 S812P probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zdbf2 T G 1: 63,304,411 C650G possibly damaging Het
Zfp282 T A 6: 47,905,327 N649K probably benign Het
Other mutations in Ggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Ggt1 APN 10 75584863 missense probably benign 0.15
IGL01593:Ggt1 APN 10 75585287 critical splice donor site probably null
IGL02713:Ggt1 APN 10 75574344 missense probably damaging 1.00
IGL03276:Ggt1 APN 10 75580497 unclassified probably benign
PIT4498001:Ggt1 UTSW 10 75578855 missense possibly damaging 0.95
R0373:Ggt1 UTSW 10 75579270 missense probably benign 0.11
R0420:Ggt1 UTSW 10 75576213 splice site probably benign
R0505:Ggt1 UTSW 10 75585957 missense probably damaging 0.99
R0630:Ggt1 UTSW 10 75585502 splice site probably null
R1837:Ggt1 UTSW 10 75579294 missense probably benign 0.00
R2655:Ggt1 UTSW 10 75581385 nonsense probably null
R2656:Ggt1 UTSW 10 75581385 nonsense probably null
R2910:Ggt1 UTSW 10 75580596 missense probably benign 0.09
R3840:Ggt1 UTSW 10 75581385 nonsense probably null
R3841:Ggt1 UTSW 10 75581385 nonsense probably null
R4744:Ggt1 UTSW 10 75585899 missense probably benign 0.00
R5254:Ggt1 UTSW 10 75579198 unclassified probably null
R5323:Ggt1 UTSW 10 75585661 critical splice acceptor site probably null
R5512:Ggt1 UTSW 10 75584884 missense probably damaging 0.99
R5579:Ggt1 UTSW 10 75585948 missense probably damaging 1.00
R5707:Ggt1 UTSW 10 75585238 missense probably benign 0.01
R5961:Ggt1 UTSW 10 75585902 unclassified probably null
R6159:Ggt1 UTSW 10 75584965 missense probably damaging 1.00
R6239:Ggt1 UTSW 10 75585681 unclassified probably null
R7224:Ggt1 UTSW 10 75574276 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTGGTATGTGCCTTTTGCC -3'
(R):5'- ATCTTCAGGCCTGCAGTCAC -3'

Sequencing Primer
(F):5'- GTATGTGCCTTTTGCCTGCCC -3'
(R):5'- CTGCAGTCACCACCTGG -3'
Posted On2016-08-04