Incidental Mutation 'R5326:Flii'
ID421980
Institutional Source Beutler Lab
Gene Symbol Flii
Ensembl Gene ENSMUSG00000002812
Gene Nameflightless I actin binding protein
SynonymsFliih, 3632430F08Rik
MMRRC Submission 042909-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5326 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60714123-60727263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60718862 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 640 (S640P)
Ref Sequence ENSEMBL: ENSMUSP00000002889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably benign
Transcript: ENSMUST00000002889
AA Change: S640P

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812
AA Change: S640P

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052346
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154465
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with gelsolin-like repeats and an N-terminal leucine-rich repeat domain. The protein is similar to a Drosophila protein involved in early embryogenesis and the structural organization of indirect flight muscle. This protein may act as an actin-remodelling protein as well as a transcriptional coactivator. Homozygous knockout mice show embryonic lethality. This protein may act to regulate wound repair. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are able to initiate uterine implantation but degenerate rapidly thereafter. Heterozygous mutant mice display enhanced wound healing with increased epithelial migration and improved wound contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,354 T127A probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Actl6b T C 5: 137,567,051 S366P probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Adgrf5 T A 17: 43,440,074 I510N probably damaging Het
Adra2a A G 19: 54,046,681 Y156C probably damaging Het
Angpt4 T C 2: 151,925,544 probably null Het
Ankdd1a T A 9: 65,504,190 probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Brd3 A G 2: 27,450,544 L551P probably benign Het
Calb2 C T 8: 110,156,978 G38D possibly damaging Het
Cand1 G A 10: 119,212,028 A519V probably benign Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Cog6 T A 3: 53,013,816 Q123L probably null Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Depdc1a T C 3: 159,526,649 V679A probably damaging Het
Dyrk1a A G 16: 94,686,581 D512G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Frs2 T C 10: 117,077,563 S121G probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Ggt1 T C 10: 75,585,706 probably null Het
Gigyf2 T C 1: 87,425,138 probably benign Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm9476 T A 10: 100,307,134 noncoding transcript Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Gmcl1 A T 6: 86,726,145 N102K possibly damaging Het
Gml T C 15: 74,816,450 N56S probably damaging Het
Gpam A C 19: 55,091,165 S128R probably benign Het
Gucy1b2 C T 14: 62,453,330 probably null Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hmx3 C T 7: 131,544,417 Q285* probably null Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighv5-17 T C 12: 113,859,258 D81G possibly damaging Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Iqcd A G 5: 120,602,375 Q257R probably damaging Het
Itpk1 T C 12: 102,573,966 N286S possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Knop1 T C 7: 118,853,272 K23E possibly damaging Het
Ksr2 T A 5: 117,708,240 V724E probably damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Morc2b T A 17: 33,136,933 T622S probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtmr2 A G 9: 13,788,647 Y38C probably damaging Het
Mycbpap A T 11: 94,507,746 probably null Het
Nadsyn1 T A 7: 143,808,830 R279W probably benign Het
Olfr1354 G A 10: 78,917,586 V249I possibly damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr689 T A 7: 105,314,439 F145Y probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Prkar1b T C 5: 139,127,789 probably null Het
Ric8b T C 10: 84,992,212 Y467H probably damaging Het
Rin1 A G 19: 5,052,624 E387G probably damaging Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Seh1l C T 18: 67,774,999 probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Snrnp70 GCGGTCCCGGTCCCGGTC GCGGTCCCGGTC 7: 45,377,233 probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Spin1 A G 13: 51,139,527 Y91C probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trim30c T A 7: 104,388,304 M152L possibly damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Wdr11 T C 7: 129,625,249 S812P probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zdbf2 T G 1: 63,304,411 C650G possibly damaging Het
Zfp282 T A 6: 47,905,327 N649K probably benign Het
Other mutations in Flii
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Flii APN 11 60723415 missense probably benign 0.03
IGL00331:Flii APN 11 60715833 missense probably benign 0.40
IGL01530:Flii APN 11 60720182 nonsense probably null
IGL01678:Flii APN 11 60716846 unclassified probably benign
IGL01938:Flii APN 11 60715116 missense probably damaging 1.00
IGL02211:Flii APN 11 60718298 unclassified probably benign
IGL02626:Flii APN 11 60719859 missense probably benign 0.37
IGL03038:Flii APN 11 60724832 missense probably benign 0.01
IGL03412:Flii APN 11 60722640 missense probably damaging 0.99
Dry_tortugas UTSW 11 60720757 nonsense probably null
R0135:Flii UTSW 11 60723378 missense probably damaging 0.99
R0350:Flii UTSW 11 60721857 missense probably damaging 1.00
R0355:Flii UTSW 11 60719680 splice site probably null
R0524:Flii UTSW 11 60720061 missense probably damaging 0.98
R0636:Flii UTSW 11 60715552 missense probably damaging 1.00
R0639:Flii UTSW 11 60722997 splice site probably null
R1515:Flii UTSW 11 60721606 critical splice acceptor site probably null
R1544:Flii UTSW 11 60719692 critical splice donor site probably null
R1782:Flii UTSW 11 60714636 missense probably benign
R2922:Flii UTSW 11 60718916 missense probably damaging 1.00
R3691:Flii UTSW 11 60719757 missense probably benign 0.03
R3753:Flii UTSW 11 60715480 missense probably benign
R3875:Flii UTSW 11 60720492 missense probably benign
R3876:Flii UTSW 11 60719872 missense possibly damaging 0.85
R3924:Flii UTSW 11 60720076 missense probably damaging 1.00
R4621:Flii UTSW 11 60716111 missense possibly damaging 0.95
R4789:Flii UTSW 11 60715093 missense probably benign 0.33
R5153:Flii UTSW 11 60716686 missense possibly damaging 0.89
R5340:Flii UTSW 11 60717268 missense probably damaging 0.99
R5364:Flii UTSW 11 60720128 missense probably benign 0.00
R5542:Flii UTSW 11 60718862 missense probably benign 0.30
R5592:Flii UTSW 11 60720399 missense probably benign 0.00
R5859:Flii UTSW 11 60716311 nonsense probably null
R5968:Flii UTSW 11 60720212 missense probably benign
R6009:Flii UTSW 11 60720757 nonsense probably null
R6287:Flii UTSW 11 60721597 missense probably damaging 1.00
R6368:Flii UTSW 11 60721136 missense probably damaging 1.00
R6997:Flii UTSW 11 60722325 missense probably benign 0.14
R7099:Flii UTSW 11 60720655 missense probably benign 0.05
X0025:Flii UTSW 11 60721708 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACTGACTCAAAAGATGGGGC -3'
(R):5'- GACATCTCCTACATTGAAGGCGG -3'

Sequencing Primer
(F):5'- ACTCAAAAGATGGGGCTCTGGTTC -3'
(R):5'- TCTCCTACATTGAAGGCGGAACAG -3'
Posted On2016-08-04