Incidental Mutation 'R5326:Adra2a'
ID422002
Institutional Source Beutler Lab
Gene Symbol Adra2a
Ensembl Gene ENSMUSG00000033717
Gene Nameadrenergic receptor, alpha 2a
Synonymsalpha2A-AR, Adra-2a, Adra-2, alpha2A, alpha2A-adrenergic receptor, alpha(2A)AR
MMRRC Submission 042909-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5326 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location54045182-54048982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54046681 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 156 (Y156C)
Ref Sequence ENSEMBL: ENSMUSP00000036203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036700]
Predicted Effect probably damaging
Transcript: ENSMUST00000036700
AA Change: Y156C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036203
Gene: ENSMUSG00000033717
AA Change: Y156C

DomainStartEndE-ValueType
Pfam:7tm_4 55 237 1.5e-7 PFAM
Pfam:7TM_GPCR_Srx 56 188 2.5e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 245 3.7e-7 PFAM
Pfam:7tm_1 65 441 1.5e-73 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,354 T127A probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Actl6b T C 5: 137,567,051 S366P probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Adgrf5 T A 17: 43,440,074 I510N probably damaging Het
Angpt4 T C 2: 151,925,544 probably null Het
Ankdd1a T A 9: 65,504,190 probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Brd3 A G 2: 27,450,544 L551P probably benign Het
Calb2 C T 8: 110,156,978 G38D possibly damaging Het
Cand1 G A 10: 119,212,028 A519V probably benign Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Cog6 T A 3: 53,013,816 Q123L probably null Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Depdc1a T C 3: 159,526,649 V679A probably damaging Het
Dyrk1a A G 16: 94,686,581 D512G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Frs2 T C 10: 117,077,563 S121G probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Ggt1 T C 10: 75,585,706 probably null Het
Gigyf2 T C 1: 87,425,138 probably benign Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm9476 T A 10: 100,307,134 noncoding transcript Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Gmcl1 A T 6: 86,726,145 N102K possibly damaging Het
Gml T C 15: 74,816,450 N56S probably damaging Het
Gpam A C 19: 55,091,165 S128R probably benign Het
Gucy1b2 C T 14: 62,453,330 probably null Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hmx3 C T 7: 131,544,417 Q285* probably null Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighv5-17 T C 12: 113,859,258 D81G possibly damaging Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Iqcd A G 5: 120,602,375 Q257R probably damaging Het
Itpk1 T C 12: 102,573,966 N286S possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Knop1 T C 7: 118,853,272 K23E possibly damaging Het
Ksr2 T A 5: 117,708,240 V724E probably damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Morc2b T A 17: 33,136,933 T622S probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtmr2 A G 9: 13,788,647 Y38C probably damaging Het
Mycbpap A T 11: 94,507,746 probably null Het
Nadsyn1 T A 7: 143,808,830 R279W probably benign Het
Olfr1354 G A 10: 78,917,586 V249I possibly damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr689 T A 7: 105,314,439 F145Y probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Prkar1b T C 5: 139,127,789 probably null Het
Ric8b T C 10: 84,992,212 Y467H probably damaging Het
Rin1 A G 19: 5,052,624 E387G probably damaging Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Seh1l C T 18: 67,774,999 probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Snrnp70 GCGGTCCCGGTCCCGGTC GCGGTCCCGGTC 7: 45,377,233 probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Spin1 A G 13: 51,139,527 Y91C probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trim30c T A 7: 104,388,304 M152L possibly damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Wdr11 T C 7: 129,625,249 S812P probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zdbf2 T G 1: 63,304,411 C650G possibly damaging Het
Zfp282 T A 6: 47,905,327 N649K probably benign Het
Other mutations in Adra2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
splenda UTSW 19 54046495 missense probably damaging 1.00
splenda2 UTSW 19 54046639 missense probably damaging 1.00
R0245:Adra2a UTSW 19 54047409 missense probably damaging 1.00
R1933:Adra2a UTSW 19 54046406 missense probably damaging 1.00
R2175:Adra2a UTSW 19 54046362 missense probably benign 0.04
R4553:Adra2a UTSW 19 54046735 missense possibly damaging 0.86
R4781:Adra2a UTSW 19 54046495 missense probably damaging 1.00
R4984:Adra2a UTSW 19 54046639 missense probably damaging 1.00
R5260:Adra2a UTSW 19 54046608 missense probably damaging 1.00
R5585:Adra2a UTSW 19 54046239 missense probably benign 0.00
R6861:Adra2a UTSW 19 54046387 missense probably damaging 1.00
R7290:Adra2a UTSW 19 54046404 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAAACCTCTTCCTGGTG -3'
(R):5'- CGAGGAGATGACATACCACTTC -3'

Sequencing Primer
(F):5'- TCAGCGGACATCCTGGTG -3'
(R):5'- CACTTCTGGTCGTTGATCTTGCAG -3'
Posted On2016-08-04