Incidental Mutation 'R5327:Adora1'
ID422010
Institutional Source Beutler Lab
Gene Symbol Adora1
Ensembl Gene ENSMUSG00000042429
Gene Nameadenosine A1 receptor
SynonymsRi, A1AR, A1R, A1-AR, AA1R
MMRRC Submission 042910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5327 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134199223-134235431 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 134203010 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 308 (R308*)
Ref Sequence ENSEMBL: ENSMUSP00000132105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038191] [ENSMUST00000038445] [ENSMUST00000086465] [ENSMUST00000169927] [ENSMUST00000187631] [ENSMUST00000191577]
Predicted Effect probably null
Transcript: ENSMUST00000038191
AA Change: R308*
SMART Domains Protein: ENSMUSP00000043522
Gene: ENSMUSG00000042429
AA Change: R308*

DomainStartEndE-ValueType
Pfam:7tm_4 17 305 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 9.8e-52 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038445
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000086465
AA Change: R308*
SMART Domains Protein: ENSMUSP00000083656
Gene: ENSMUSG00000042429
AA Change: R308*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169927
AA Change: R308*
SMART Domains Protein: ENSMUSP00000132105
Gene: ENSMUSG00000042429
AA Change: R308*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187631
SMART Domains Protein: ENSMUSP00000140801
Gene: ENSMUSG00000042429

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 17 146 1.2e-4 PFAM
Pfam:7TM_GPCR_Srsx 20 148 1.6e-9 PFAM
Pfam:7tm_1 26 176 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191577
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Meta Mutation Damage Score 0.6624 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adenosine receptor that belongs to the G-protein coupled receptor 1 family. There are 3 types of adenosine receptors, each with a specific pattern of ligand binding and tissue distribution, and together they regulate a diverse set of physiologic functions. The type A1 receptors inhibit adenylyl cyclase, and play a role in the fertilization process. Animal studies also suggest a role for A1 receptors in kidney function and ethanol intoxication. Transcript variants with alternative splicing in the 5' UTR have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele exhibit allodynia, hyperalgesia, increased anxiety, and decreased hypoxic neuroprotection. Homozygotes for a different null allele show increased susceptibility to kidney reperfusion injury and absent tubuloglomerular feedback response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,003 S36G probably damaging Het
Aarsd1 T C 11: 101,410,377 N280D probably benign Het
Abca2 T A 2: 25,445,674 M2099K probably damaging Het
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Acss2 T A 2: 155,573,229 L682Q probably null Het
Adamts14 G A 10: 61,198,488 P1207L probably benign Het
Arcn1 A T 9: 44,757,147 V264E probably benign Het
B3galt1 G A 2: 68,118,768 G276S probably damaging Het
Bms1 A T 6: 118,405,218 M453K possibly damaging Het
Bnip3l T C 14: 66,987,731 Y218C probably damaging Het
Cacna2d2 A G 9: 107,513,606 E379G probably null Het
Cacng6 G A 7: 3,434,860 G235R probably damaging Het
Capn8 A T 1: 182,628,604 T640S probably benign Het
Ccdc106 T C 7: 5,060,160 probably benign Het
Ccdc33 A T 9: 58,086,577 N95K probably benign Het
Celsr3 T A 9: 108,842,708 probably benign Het
Cemip A T 7: 83,955,301 N844K probably damaging Het
Chrdl2 A T 7: 100,028,741 T284S probably damaging Het
Ckm A G 7: 19,420,165 Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 I236F probably damaging Het
Col9a1 T C 1: 24,195,539 probably null Het
Csmd1 T C 8: 17,216,712 E66G possibly damaging Het
Ctdsp2 A G 10: 126,996,054 D26G probably damaging Het
Ctsll3 C A 13: 60,798,907 probably null Het
Cyp2d12 A T 15: 82,555,222 M26L probably benign Het
Cyp8b1 C T 9: 121,914,884 D461N probably damaging Het
Dbt A T 3: 116,528,571 probably benign Het
Dnah7c A G 1: 46,665,568 D2247G probably benign Het
Dsg1c A G 18: 20,267,937 I166V possibly damaging Het
Duoxa1 T A 2: 122,303,880 E252D probably damaging Het
Ezr T A 17: 6,753,049 K211M probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fahd2a T C 2: 127,441,958 D54G possibly damaging Het
Fbxo9 A T 9: 78,095,864 probably null Het
Fndc1 A G 17: 7,772,708 S719P unknown Het
Gas7 G T 11: 67,662,090 G159C probably damaging Het
Gba2 T C 4: 43,574,063 D130G probably damaging Het
Gli3 T G 13: 15,548,507 S78A probably damaging Het
Gtpbp6 A G 5: 110,106,904 F101S probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Hmbox1 G A 14: 64,896,695 S152L possibly damaging Het
Ibtk A G 9: 85,737,466 probably null Het
Jade1 T C 3: 41,613,978 I827T possibly damaging Het
Jakmip3 A T 7: 139,025,435 E389D possibly damaging Het
Klhdc8b A T 9: 108,449,042 probably benign Het
Lama2 T C 10: 27,138,946 T1589A probably benign Het
Lbx2 A C 6: 83,087,803 K107T probably damaging Het
Ldha A G 7: 46,854,098 M259V probably benign Het
Lrrtm4 A G 6: 80,022,637 K344R probably damaging Het
Ltb A T 17: 35,195,959 E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Map3k13 T A 16: 21,921,647 S575T possibly damaging Het
Mcpt2 A T 14: 56,043,376 I74F probably damaging Het
Mpeg1 T A 19: 12,461,649 V157D probably damaging Het
Mrpl21 A T 19: 3,287,009 probably null Het
Nagpa T C 16: 5,200,013 T99A possibly damaging Het
Nphs1 A T 7: 30,463,825 I469F probably benign Het
Nyap2 A G 1: 81,192,041 E171G possibly damaging Het
Oas1e A G 5: 120,791,941 Y171H probably damaging Het
Olfr1129 T A 2: 87,575,699 V205D probably damaging Het
Olfr1392 T C 11: 49,293,666 L115P probably damaging Het
Olfr196 T C 16: 59,167,620 I174M possibly damaging Het
Olfr205 T C 16: 59,329,098 K137R probably benign Het
Otud7b C A 3: 96,155,738 Q765K probably benign Het
Pdzd7 A G 19: 45,028,777 V851A probably benign Het
Pi4ka T G 16: 17,325,413 K794T probably damaging Het
Pkhd1l1 T A 15: 44,546,862 N2588K probably damaging Het
Pla2g6 A T 15: 79,302,637 M471K probably benign Het
Plagl2 T C 2: 153,235,839 H74R possibly damaging Het
Prf1 T A 10: 61,300,258 N104K probably benign Het
Ptprf A T 4: 118,236,389 I358N probably damaging Het
Rcsd1 A G 1: 165,655,303 probably null Het
Rev1 G A 1: 38,108,451 R3* probably null Het
Rp1 T C 1: 4,349,360 probably null Het
Rrp12 G A 19: 41,892,596 T132I probably damaging Het
Sema3a T C 5: 13,599,389 V702A probably benign Het
Serpinb12 A G 1: 106,956,444 N307D probably damaging Het
Slc35d1 A G 4: 103,213,186 L103P probably damaging Het
Smyd4 T C 11: 75,390,939 C413R probably damaging Het
Stab1 G A 14: 31,161,836 Q255* probably null Het
Synpo T A 18: 60,603,846 I343F possibly damaging Het
Tcirg1 A G 19: 3,902,342 probably null Het
Tmem132c A G 5: 127,563,752 T996A possibly damaging Het
Trim10 A G 17: 36,870,189 E104G probably damaging Het
Trpc1 T C 9: 95,721,471 probably null Het
Tspo2 A T 17: 48,449,859 probably benign Het
Ugt2a3 A T 5: 87,331,315 I258N probably damaging Het
Usp34 T C 11: 23,468,846 L2998P probably damaging Het
Vmn1r45 A C 6: 89,933,141 D162E possibly damaging Het
Vmn2r117 A T 17: 23,477,874 Y186* probably null Het
Vmn2r67 A G 7: 85,136,490 F769S probably damaging Het
Zbtb17 A G 4: 141,465,631 I514V probably benign Het
Zfp329 A C 7: 12,811,494 D34E probably benign Het
Other mutations in Adora1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Adora1 APN 1 134203213 missense probably damaging 1.00
IGL01641:Adora1 APN 1 134234114 missense probably damaging 1.00
IGL03025:Adora1 APN 1 134203069 missense probably damaging 1.00
R4378:Adora1 UTSW 1 134203210 missense probably damaging 0.96
R5248:Adora1 UTSW 1 134203486 missense possibly damaging 0.49
R5408:Adora1 UTSW 1 134203163 missense probably benign 0.02
R6810:Adora1 UTSW 1 134234039 missense probably damaging 1.00
X0028:Adora1 UTSW 1 134203576 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACAGAAGGGGCCCTGTTC -3'
(R):5'- GCTACACATCTTGAACTGCATC -3'

Sequencing Primer
(F):5'- GTTCCATGGCATCTCTTCAGAG -3'
(R):5'- ACATCTTGAACTGCATCACCCTC -3'
Posted On2016-08-04