Incidental Mutation 'R5327:Gas7'
ID422066
Institutional Source Beutler Lab
Gene Symbol Gas7
Ensembl Gene ENSMUSG00000033066
Gene Namegrowth arrest specific 7
SynonymsB230343A10Rik, Gas7-cb
MMRRC Submission 042910-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R5327 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67455437-67688990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67662090 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 159 (G159C)
Ref Sequence ENSEMBL: ENSMUSP00000104322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000041611] [ENSMUST00000108680] [ENSMUST00000108681] [ENSMUST00000108682]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041611
AA Change: G155C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038420
Gene: ENSMUSG00000033066
AA Change: G155C

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108680
AA Change: G155C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104320
Gene: ENSMUSG00000033066
AA Change: G155C

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108681
AA Change: G155C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104321
Gene: ENSMUSG00000033066
AA Change: G155C

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108682
AA Change: G159C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104322
Gene: ENSMUSG00000033066
AA Change: G159C

DomainStartEndE-ValueType
WW 18 50 1.39e-11 SMART
FCH 150 236 6.62e-25 SMART
coiled coil region 264 308 N/A INTRINSIC
low complexity region 339 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151784
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Growth arrest-specific 7 is expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development. Several transcript variants encoding proteins which vary in the N-terminus have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged mice homozygous for a hypomorphic allele show impaired coordination, decreased grip strength, decreased motor neuron number, muscle weakness, abnormal skeletal muscle fiber type ratio in the soleus muscle, and defects in motor neuron axon terminal sprouting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,003 S36G probably damaging Het
Aarsd1 T C 11: 101,410,377 N280D probably benign Het
Abca2 T A 2: 25,445,674 M2099K probably damaging Het
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Acss2 T A 2: 155,573,229 L682Q probably null Het
Adamts14 G A 10: 61,198,488 P1207L probably benign Het
Adora1 G A 1: 134,203,010 R308* probably null Het
Arcn1 A T 9: 44,757,147 V264E probably benign Het
B3galt1 G A 2: 68,118,768 G276S probably damaging Het
Bms1 A T 6: 118,405,218 M453K possibly damaging Het
Bnip3l T C 14: 66,987,731 Y218C probably damaging Het
Cacna2d2 A G 9: 107,513,606 E379G probably null Het
Cacng6 G A 7: 3,434,860 G235R probably damaging Het
Capn8 A T 1: 182,628,604 T640S probably benign Het
Ccdc106 T C 7: 5,060,160 probably benign Het
Ccdc33 A T 9: 58,086,577 N95K probably benign Het
Celsr3 T A 9: 108,842,708 probably benign Het
Cemip A T 7: 83,955,301 N844K probably damaging Het
Chrdl2 A T 7: 100,028,741 T284S probably damaging Het
Ckm A G 7: 19,420,165 Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 I236F probably damaging Het
Col9a1 T C 1: 24,195,539 probably null Het
Csmd1 T C 8: 17,216,712 E66G possibly damaging Het
Ctdsp2 A G 10: 126,996,054 D26G probably damaging Het
Ctsll3 C A 13: 60,798,907 probably null Het
Cyp2d12 A T 15: 82,555,222 M26L probably benign Het
Cyp8b1 C T 9: 121,914,884 D461N probably damaging Het
Dbt A T 3: 116,528,571 probably benign Het
Dnah7c A G 1: 46,665,568 D2247G probably benign Het
Dsg1c A G 18: 20,267,937 I166V possibly damaging Het
Duoxa1 T A 2: 122,303,880 E252D probably damaging Het
Ezr T A 17: 6,753,049 K211M probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fahd2a T C 2: 127,441,958 D54G possibly damaging Het
Fbxo9 A T 9: 78,095,864 probably null Het
Fndc1 A G 17: 7,772,708 S719P unknown Het
Gba2 T C 4: 43,574,063 D130G probably damaging Het
Gli3 T G 13: 15,548,507 S78A probably damaging Het
Gtpbp6 A G 5: 110,106,904 F101S probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Hmbox1 G A 14: 64,896,695 S152L possibly damaging Het
Ibtk A G 9: 85,737,466 probably null Het
Jade1 T C 3: 41,613,978 I827T possibly damaging Het
Jakmip3 A T 7: 139,025,435 E389D possibly damaging Het
Klhdc8b A T 9: 108,449,042 probably benign Het
Lama2 T C 10: 27,138,946 T1589A probably benign Het
Lbx2 A C 6: 83,087,803 K107T probably damaging Het
Ldha A G 7: 46,854,098 M259V probably benign Het
Lrrtm4 A G 6: 80,022,637 K344R probably damaging Het
Ltb A T 17: 35,195,959 E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Map3k13 T A 16: 21,921,647 S575T possibly damaging Het
Mcpt2 A T 14: 56,043,376 I74F probably damaging Het
Mpeg1 T A 19: 12,461,649 V157D probably damaging Het
Mrpl21 A T 19: 3,287,009 probably null Het
Nagpa T C 16: 5,200,013 T99A possibly damaging Het
Nphs1 A T 7: 30,463,825 I469F probably benign Het
Nyap2 A G 1: 81,192,041 E171G possibly damaging Het
Oas1e A G 5: 120,791,941 Y171H probably damaging Het
Olfr1129 T A 2: 87,575,699 V205D probably damaging Het
Olfr1392 T C 11: 49,293,666 L115P probably damaging Het
Olfr196 T C 16: 59,167,620 I174M possibly damaging Het
Olfr205 T C 16: 59,329,098 K137R probably benign Het
Otud7b C A 3: 96,155,738 Q765K probably benign Het
Pdzd7 A G 19: 45,028,777 V851A probably benign Het
Pi4ka T G 16: 17,325,413 K794T probably damaging Het
Pkhd1l1 T A 15: 44,546,862 N2588K probably damaging Het
Pla2g6 A T 15: 79,302,637 M471K probably benign Het
Plagl2 T C 2: 153,235,839 H74R possibly damaging Het
Prf1 T A 10: 61,300,258 N104K probably benign Het
Ptprf A T 4: 118,236,389 I358N probably damaging Het
Rcsd1 A G 1: 165,655,303 probably null Het
Rev1 G A 1: 38,108,451 R3* probably null Het
Rp1 T C 1: 4,349,360 probably null Het
Rrp12 G A 19: 41,892,596 T132I probably damaging Het
Sema3a T C 5: 13,599,389 V702A probably benign Het
Serpinb12 A G 1: 106,956,444 N307D probably damaging Het
Slc35d1 A G 4: 103,213,186 L103P probably damaging Het
Smyd4 T C 11: 75,390,939 C413R probably damaging Het
Stab1 G A 14: 31,161,836 Q255* probably null Het
Synpo T A 18: 60,603,846 I343F possibly damaging Het
Tcirg1 A G 19: 3,902,342 probably null Het
Tmem132c A G 5: 127,563,752 T996A possibly damaging Het
Trim10 A G 17: 36,870,189 E104G probably damaging Het
Trpc1 T C 9: 95,721,471 probably null Het
Tspo2 A T 17: 48,449,859 probably benign Het
Ugt2a3 A T 5: 87,331,315 I258N probably damaging Het
Usp34 T C 11: 23,468,846 L2998P probably damaging Het
Vmn1r45 A C 6: 89,933,141 D162E possibly damaging Het
Vmn2r117 A T 17: 23,477,874 Y186* probably null Het
Vmn2r67 A G 7: 85,136,490 F769S probably damaging Het
Zbtb17 A G 4: 141,465,631 I514V probably benign Het
Zfp329 A C 7: 12,811,494 D34E probably benign Het
Other mutations in Gas7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Gas7 APN 11 67652914 critical splice donor site probably null
IGL01634:Gas7 APN 11 67674231 splice site probably benign
IGL02215:Gas7 APN 11 67643332 missense probably benign 0.33
IGL02338:Gas7 APN 11 67682731 missense probably damaging 0.99
IGL02547:Gas7 APN 11 67665435 missense probably damaging 0.99
IGL02679:Gas7 APN 11 67675727 splice site probably null
IGL02959:Gas7 APN 11 67674235 splice site probably benign
R0029:Gas7 UTSW 11 67643337 missense probably benign 0.05
R0335:Gas7 UTSW 11 67662052 missense possibly damaging 0.84
R0931:Gas7 UTSW 11 67652925 splice site probably benign
R1165:Gas7 UTSW 11 67670686 splice site probably benign
R1459:Gas7 UTSW 11 67662076 missense probably damaging 1.00
R2425:Gas7 UTSW 11 67643295 missense probably benign 0.00
R4953:Gas7 UTSW 11 67660050 missense possibly damaging 0.69
R4969:Gas7 UTSW 11 67683408 missense probably damaging 0.98
R6145:Gas7 UTSW 11 67629612 missense probably damaging 1.00
R6631:Gas7 UTSW 11 67674281 missense probably damaging 1.00
R6885:Gas7 UTSW 11 67683387 missense probably damaging 0.99
R6914:Gas7 UTSW 11 67660151 intron probably null
R6942:Gas7 UTSW 11 67660151 intron probably null
Predicted Primers PCR Primer
(F):5'- TACACATCTTCAGTGCCCAC -3'
(R):5'- ACATTTGCTAGCCACATCTGTC -3'

Sequencing Primer
(F):5'- CAGTTTCACTGTGCTCAGAAC -3'
(R):5'- TAGCCACATCTGTCCCAGG -3'
Posted On2016-08-04