Incidental Mutation 'R5327:Gli3'
ID422072
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission 042910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5327 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15548507 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 78 (S78A)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065] [ENSMUST00000141194]
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: S78A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S78A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130065
AA Change: S78A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: S78A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130535
Predicted Effect probably benign
Transcript: ENSMUST00000141194
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,003 S36G probably damaging Het
Aarsd1 T C 11: 101,410,377 N280D probably benign Het
Abca2 T A 2: 25,445,674 M2099K probably damaging Het
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Acss2 T A 2: 155,573,229 L682Q probably null Het
Adamts14 G A 10: 61,198,488 P1207L probably benign Het
Adora1 G A 1: 134,203,010 R308* probably null Het
Arcn1 A T 9: 44,757,147 V264E probably benign Het
B3galt1 G A 2: 68,118,768 G276S probably damaging Het
Bms1 A T 6: 118,405,218 M453K possibly damaging Het
Bnip3l T C 14: 66,987,731 Y218C probably damaging Het
Cacna2d2 A G 9: 107,513,606 E379G probably null Het
Cacng6 G A 7: 3,434,860 G235R probably damaging Het
Capn8 A T 1: 182,628,604 T640S probably benign Het
Ccdc106 T C 7: 5,060,160 probably benign Het
Ccdc33 A T 9: 58,086,577 N95K probably benign Het
Celsr3 T A 9: 108,842,708 probably benign Het
Cemip A T 7: 83,955,301 N844K probably damaging Het
Chrdl2 A T 7: 100,028,741 T284S probably damaging Het
Ckm A G 7: 19,420,165 Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 I236F probably damaging Het
Col9a1 T C 1: 24,195,539 probably null Het
Csmd1 T C 8: 17,216,712 E66G possibly damaging Het
Ctdsp2 A G 10: 126,996,054 D26G probably damaging Het
Ctsll3 C A 13: 60,798,907 probably null Het
Cyp2d12 A T 15: 82,555,222 M26L probably benign Het
Cyp8b1 C T 9: 121,914,884 D461N probably damaging Het
Dbt A T 3: 116,528,571 probably benign Het
Dnah7c A G 1: 46,665,568 D2247G probably benign Het
Dsg1c A G 18: 20,267,937 I166V possibly damaging Het
Duoxa1 T A 2: 122,303,880 E252D probably damaging Het
Ezr T A 17: 6,753,049 K211M probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fahd2a T C 2: 127,441,958 D54G possibly damaging Het
Fbxo9 A T 9: 78,095,864 probably null Het
Fndc1 A G 17: 7,772,708 S719P unknown Het
Gas7 G T 11: 67,662,090 G159C probably damaging Het
Gba2 T C 4: 43,574,063 D130G probably damaging Het
Gtpbp6 A G 5: 110,106,904 F101S probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Hmbox1 G A 14: 64,896,695 S152L possibly damaging Het
Ibtk A G 9: 85,737,466 probably null Het
Jade1 T C 3: 41,613,978 I827T possibly damaging Het
Jakmip3 A T 7: 139,025,435 E389D possibly damaging Het
Klhdc8b A T 9: 108,449,042 probably benign Het
Lama2 T C 10: 27,138,946 T1589A probably benign Het
Lbx2 A C 6: 83,087,803 K107T probably damaging Het
Ldha A G 7: 46,854,098 M259V probably benign Het
Lrrtm4 A G 6: 80,022,637 K344R probably damaging Het
Ltb A T 17: 35,195,959 E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Map3k13 T A 16: 21,921,647 S575T possibly damaging Het
Mcpt2 A T 14: 56,043,376 I74F probably damaging Het
Mpeg1 T A 19: 12,461,649 V157D probably damaging Het
Mrpl21 A T 19: 3,287,009 probably null Het
Nagpa T C 16: 5,200,013 T99A possibly damaging Het
Nphs1 A T 7: 30,463,825 I469F probably benign Het
Nyap2 A G 1: 81,192,041 E171G possibly damaging Het
Oas1e A G 5: 120,791,941 Y171H probably damaging Het
Olfr1129 T A 2: 87,575,699 V205D probably damaging Het
Olfr1392 T C 11: 49,293,666 L115P probably damaging Het
Olfr196 T C 16: 59,167,620 I174M possibly damaging Het
Olfr205 T C 16: 59,329,098 K137R probably benign Het
Otud7b C A 3: 96,155,738 Q765K probably benign Het
Pdzd7 A G 19: 45,028,777 V851A probably benign Het
Pi4ka T G 16: 17,325,413 K794T probably damaging Het
Pkhd1l1 T A 15: 44,546,862 N2588K probably damaging Het
Pla2g6 A T 15: 79,302,637 M471K probably benign Het
Plagl2 T C 2: 153,235,839 H74R possibly damaging Het
Prf1 T A 10: 61,300,258 N104K probably benign Het
Ptprf A T 4: 118,236,389 I358N probably damaging Het
Rcsd1 A G 1: 165,655,303 probably null Het
Rev1 G A 1: 38,108,451 R3* probably null Het
Rp1 T C 1: 4,349,360 probably null Het
Rrp12 G A 19: 41,892,596 T132I probably damaging Het
Sema3a T C 5: 13,599,389 V702A probably benign Het
Serpinb12 A G 1: 106,956,444 N307D probably damaging Het
Slc35d1 A G 4: 103,213,186 L103P probably damaging Het
Smyd4 T C 11: 75,390,939 C413R probably damaging Het
Stab1 G A 14: 31,161,836 Q255* probably null Het
Synpo T A 18: 60,603,846 I343F possibly damaging Het
Tcirg1 A G 19: 3,902,342 probably null Het
Tmem132c A G 5: 127,563,752 T996A possibly damaging Het
Trim10 A G 17: 36,870,189 E104G probably damaging Het
Trpc1 T C 9: 95,721,471 probably null Het
Tspo2 A T 17: 48,449,859 probably benign Het
Ugt2a3 A T 5: 87,331,315 I258N probably damaging Het
Usp34 T C 11: 23,468,846 L2998P probably damaging Het
Vmn1r45 A C 6: 89,933,141 D162E possibly damaging Het
Vmn2r117 A T 17: 23,477,874 Y186* probably null Het
Vmn2r67 A G 7: 85,136,490 F769S probably damaging Het
Zbtb17 A G 4: 141,465,631 I514V probably benign Het
Zfp329 A C 7: 12,811,494 D34E probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACAAAGGAGGTTTCTTCCC -3'
(R):5'- CCCATGTCTCTCAGAAAATGTG -3'

Sequencing Primer
(F):5'- GAGGTTTCTTCCCTACAGAGAGAAC -3'
(R):5'- GTGCTAATTGGCAGGAAGTACTTAC -3'
Posted On2016-08-04