Incidental Mutation 'R5327:Pi4ka'
ID422083
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 042910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5327 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 17325413 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 794 (K794T)
Ref Sequence ENSEMBL: ENSMUSP00000122550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000139768] [ENSMUST00000154364] [ENSMUST00000231651] [ENSMUST00000232232]
Predicted Effect probably damaging
Transcript: ENSMUST00000036161
AA Change: K794T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: K794T

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132300
Predicted Effect probably damaging
Transcript: ENSMUST00000139768
AA Change: K11T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000154364
AA Change: K794T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: K794T

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231651
AA Change: K11T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231961
Predicted Effect unknown
Transcript: ENSMUST00000232232
AA Change: K794T
Predicted Effect unknown
Transcript: ENSMUST00000232404
AA Change: K116T
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,003 S36G probably damaging Het
Aarsd1 T C 11: 101,410,377 N280D probably benign Het
Abca2 T A 2: 25,445,674 M2099K probably damaging Het
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Acss2 T A 2: 155,573,229 L682Q probably null Het
Adamts14 G A 10: 61,198,488 P1207L probably benign Het
Adora1 G A 1: 134,203,010 R308* probably null Het
Arcn1 A T 9: 44,757,147 V264E probably benign Het
B3galt1 G A 2: 68,118,768 G276S probably damaging Het
Bms1 A T 6: 118,405,218 M453K possibly damaging Het
Bnip3l T C 14: 66,987,731 Y218C probably damaging Het
Cacna2d2 A G 9: 107,513,606 E379G probably null Het
Cacng6 G A 7: 3,434,860 G235R probably damaging Het
Capn8 A T 1: 182,628,604 T640S probably benign Het
Ccdc106 T C 7: 5,060,160 probably benign Het
Ccdc33 A T 9: 58,086,577 N95K probably benign Het
Celsr3 T A 9: 108,842,708 probably benign Het
Cemip A T 7: 83,955,301 N844K probably damaging Het
Chrdl2 A T 7: 100,028,741 T284S probably damaging Het
Ckm A G 7: 19,420,165 Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 I236F probably damaging Het
Col9a1 T C 1: 24,195,539 probably null Het
Csmd1 T C 8: 17,216,712 E66G possibly damaging Het
Ctdsp2 A G 10: 126,996,054 D26G probably damaging Het
Ctsll3 C A 13: 60,798,907 probably null Het
Cyp2d12 A T 15: 82,555,222 M26L probably benign Het
Cyp8b1 C T 9: 121,914,884 D461N probably damaging Het
Dbt A T 3: 116,528,571 probably benign Het
Dnah7c A G 1: 46,665,568 D2247G probably benign Het
Dsg1c A G 18: 20,267,937 I166V possibly damaging Het
Duoxa1 T A 2: 122,303,880 E252D probably damaging Het
Ezr T A 17: 6,753,049 K211M probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fahd2a T C 2: 127,441,958 D54G possibly damaging Het
Fbxo9 A T 9: 78,095,864 probably null Het
Fndc1 A G 17: 7,772,708 S719P unknown Het
Gas7 G T 11: 67,662,090 G159C probably damaging Het
Gba2 T C 4: 43,574,063 D130G probably damaging Het
Gli3 T G 13: 15,548,507 S78A probably damaging Het
Gtpbp6 A G 5: 110,106,904 F101S probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Hmbox1 G A 14: 64,896,695 S152L possibly damaging Het
Ibtk A G 9: 85,737,466 probably null Het
Jade1 T C 3: 41,613,978 I827T possibly damaging Het
Jakmip3 A T 7: 139,025,435 E389D possibly damaging Het
Klhdc8b A T 9: 108,449,042 probably benign Het
Lama2 T C 10: 27,138,946 T1589A probably benign Het
Lbx2 A C 6: 83,087,803 K107T probably damaging Het
Ldha A G 7: 46,854,098 M259V probably benign Het
Lrrtm4 A G 6: 80,022,637 K344R probably damaging Het
Ltb A T 17: 35,195,959 E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Map3k13 T A 16: 21,921,647 S575T possibly damaging Het
Mcpt2 A T 14: 56,043,376 I74F probably damaging Het
Mpeg1 T A 19: 12,461,649 V157D probably damaging Het
Mrpl21 A T 19: 3,287,009 probably null Het
Nagpa T C 16: 5,200,013 T99A possibly damaging Het
Nphs1 A T 7: 30,463,825 I469F probably benign Het
Nyap2 A G 1: 81,192,041 E171G possibly damaging Het
Oas1e A G 5: 120,791,941 Y171H probably damaging Het
Olfr1129 T A 2: 87,575,699 V205D probably damaging Het
Olfr1392 T C 11: 49,293,666 L115P probably damaging Het
Olfr196 T C 16: 59,167,620 I174M possibly damaging Het
Olfr205 T C 16: 59,329,098 K137R probably benign Het
Otud7b C A 3: 96,155,738 Q765K probably benign Het
Pdzd7 A G 19: 45,028,777 V851A probably benign Het
Pkhd1l1 T A 15: 44,546,862 N2588K probably damaging Het
Pla2g6 A T 15: 79,302,637 M471K probably benign Het
Plagl2 T C 2: 153,235,839 H74R possibly damaging Het
Prf1 T A 10: 61,300,258 N104K probably benign Het
Ptprf A T 4: 118,236,389 I358N probably damaging Het
Rcsd1 A G 1: 165,655,303 probably null Het
Rev1 G A 1: 38,108,451 R3* probably null Het
Rp1 T C 1: 4,349,360 probably null Het
Rrp12 G A 19: 41,892,596 T132I probably damaging Het
Sema3a T C 5: 13,599,389 V702A probably benign Het
Serpinb12 A G 1: 106,956,444 N307D probably damaging Het
Slc35d1 A G 4: 103,213,186 L103P probably damaging Het
Smyd4 T C 11: 75,390,939 C413R probably damaging Het
Stab1 G A 14: 31,161,836 Q255* probably null Het
Synpo T A 18: 60,603,846 I343F possibly damaging Het
Tcirg1 A G 19: 3,902,342 probably null Het
Tmem132c A G 5: 127,563,752 T996A possibly damaging Het
Trim10 A G 17: 36,870,189 E104G probably damaging Het
Trpc1 T C 9: 95,721,471 probably null Het
Tspo2 A T 17: 48,449,859 probably benign Het
Ugt2a3 A T 5: 87,331,315 I258N probably damaging Het
Usp34 T C 11: 23,468,846 L2998P probably damaging Het
Vmn1r45 A C 6: 89,933,141 D162E possibly damaging Het
Vmn2r117 A T 17: 23,477,874 Y186* probably null Het
Vmn2r67 A G 7: 85,136,490 F769S probably damaging Het
Zbtb17 A G 4: 141,465,631 I514V probably benign Het
Zfp329 A C 7: 12,811,494 D34E probably benign Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGTACTTCGGAGCTCACTC -3'
(R):5'- CTGTGCTGGGAAAATGTCCTTAC -3'

Sequencing Primer
(F):5'- TCGGAGCTCACTCAGTTCAG -3'
(R):5'- ACTCATTTGGTCAGGTGGCCTAC -3'
Posted On2016-08-04