Incidental Mutation 'R5328:Olfr332'
ID422159
Institutional Source Beutler Lab
Gene Symbol Olfr332
Ensembl Gene ENSMUSG00000050813
Gene Nameolfactory receptor 332
SynonymsGA_x6K02T2NKPP-926908-927915, MOR284-2
MMRRC Submission 042843-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5328 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58487950-58492555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58490429 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 109 (A109S)
Ref Sequence ENSEMBL: ENSMUSP00000136008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180165] [ENSMUST00000203744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000180165
AA Change: A109S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136008
Gene: ENSMUSG00000050813
AA Change: A109S

DomainStartEndE-ValueType
Pfam:7tm_1 40 289 6.8e-33 PFAM
Pfam:7tm_4 138 282 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203744
AA Change: A10S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,837,694 V860E possibly damaging Het
Abcc6 T C 7: 45,992,311 D881G probably benign Het
Abcc9 A G 6: 142,682,059 V415A probably benign Het
Adgrb3 A C 1: 25,094,275 N1003K possibly damaging Het
Adora3 C T 3: 105,907,303 T123I probably benign Het
Amotl2 A C 9: 102,723,768 T345P probably benign Het
Arap3 C T 18: 37,991,687 E247K possibly damaging Het
Atp8b1 A T 18: 64,531,391 D1235E probably benign Het
Axl A T 7: 25,773,411 V400E probably damaging Het
Brd8 T A 18: 34,607,981 N431Y probably benign Het
Cadps A T 14: 12,457,790 N1025K probably benign Het
Cblc A T 7: 19,792,580 S195T possibly damaging Het
Chd2 C T 7: 73,463,681 A1184T possibly damaging Het
Chst10 G A 1: 38,895,962 probably benign Het
Col12a1 T C 9: 79,620,060 K2663E probably damaging Het
Cspg4 A T 9: 56,885,856 I292L probably benign Het
Cul1 T C 6: 47,508,317 V294A probably damaging Het
Cyp2d11 G A 15: 82,391,771 P203L probably benign Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eif3l A T 15: 79,093,361 K534* probably null Het
Enpep T C 3: 129,280,510 E796G probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam117a T A 11: 95,364,170 probably null Het
Fan1 A T 7: 64,354,469 Y750N probably damaging Het
Fat4 T A 3: 38,956,868 I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 D106Y probably damaging Het
Gak A C 5: 108,617,001 C145G possibly damaging Het
Galnt14 A T 17: 73,505,459 N406K possibly damaging Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm10837 G T 14: 122,490,778 R22L unknown Het
Gm19965 T A 1: 116,821,418 H276Q possibly damaging Het
Gm43517 T C 12: 49,391,156 probably benign Het
Gm9733 T C 3: 15,332,174 M17V unknown Het
Greb1l A T 18: 10,553,720 I1574F probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Heatr5b G A 17: 78,826,362 T266I possibly damaging Het
Hk3 T C 13: 55,013,493 I185V probably benign Het
Hnrnpr A G 4: 136,339,216 E302G probably benign Het
Itgal T C 7: 127,311,675 probably null Het
Itk A G 11: 46,331,876 S583P probably benign Het
Loxhd1 A T 18: 77,410,572 I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Man2a2 A T 7: 80,368,756 F118L probably benign Het
Mfsd5 T A 15: 102,281,012 V273E probably damaging Het
Nfe2l2 A G 2: 75,676,856 L300P probably damaging Het
Nt5c1a T G 4: 123,208,993 L122R possibly damaging Het
Nt5c3b A G 11: 100,440,241 F42S probably damaging Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Pabpc1 A T 15: 36,602,877 D204E probably benign Het
Panx2 A G 15: 89,068,095 N255S probably damaging Het
Pcnt A G 10: 76,411,719 L993P probably damaging Het
Pfas A T 11: 68,988,592 C1160S probably damaging Het
Plekhh3 T A 11: 101,167,658 probably benign Het
Plod3 T A 5: 136,989,683 N258K probably damaging Het
Prr14l T C 5: 32,830,021 Q710R probably benign Het
Rnf216 G T 5: 143,092,999 T65K possibly damaging Het
Samd9l T C 6: 3,376,739 E174G probably damaging Het
Sept12 T A 16: 4,993,993 M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,577,456 D22E probably benign Het
Skil A G 3: 31,117,569 K488R probably benign Het
Slamf6 T A 1: 171,938,095 I262K probably benign Het
Slc27a3 T C 3: 90,386,832 D470G probably damaging Het
Sorbs3 A T 14: 70,181,174 V680E probably damaging Het
Sox9 C T 11: 112,782,658 T25I probably benign Het
Srsf1 G T 11: 88,049,993 probably benign Het
Stard9 A C 2: 120,699,230 E1989D probably damaging Het
Thumpd2 T A 17: 81,044,162 I277F possibly damaging Het
Tinag C A 9: 77,005,631 G299* probably null Het
Tk2 A T 8: 104,229,299 probably null Het
Tmem44 A G 16: 30,540,891 S210P possibly damaging Het
Traf3ip1 C A 1: 91,520,069 P423T probably damaging Het
Trmt12 A G 15: 58,872,855 D34G probably damaging Het
Ttc39b A G 4: 83,261,941 Y72H probably damaging Het
Ttn G A 2: 76,878,411 probably benign Het
Ttyh2 T A 11: 114,710,068 I381N possibly damaging Het
Uaca A T 9: 60,870,532 N734Y probably benign Het
Usp34 T C 11: 23,464,616 I2853T probably benign Het
Usp34 G A 11: 23,488,659 G3407D probably benign Het
Vmn2r78 A G 7: 86,921,030 Y252C probably damaging Het
Wdr19 G A 5: 65,244,179 C979Y probably damaging Het
Wdr92 C A 11: 17,222,220 P103Q probably damaging Het
Yeats2 A T 16: 20,171,205 H277L probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfat C A 15: 68,179,828 G706C probably damaging Het
Zfp106 A T 2: 120,520,417 N1584K possibly damaging Het
Other mutations in Olfr332
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Olfr332 APN 11 58490539 missense probably damaging 1.00
R1671:Olfr332 UTSW 11 58490609 missense possibly damaging 0.63
R2193:Olfr332 UTSW 11 58489906 missense probably damaging 0.97
R2393:Olfr332 UTSW 11 58490720 missense probably benign 0.20
R4713:Olfr332 UTSW 11 58490087 missense probably benign 0.01
R5636:Olfr332 UTSW 11 58490051 missense probably damaging 1.00
R6092:Olfr332 UTSW 11 58490074 missense probably damaging 1.00
R7011:Olfr332 UTSW 11 58490144 missense possibly damaging 0.69
R7172:Olfr332 UTSW 11 58489745 missense unknown
R7427:Olfr332 UTSW 11 58489780 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTAATGGTTGATCTCCCTGGAG -3'
(R):5'- TGATACTCCTCATCTGGCTGG -3'

Sequencing Primer
(F):5'- GATCTCCCTGGAGCCACAGATAG -3'
(R):5'- TCATCTGGCTGGACCCC -3'
Posted On2016-08-04