Incidental Mutation 'R5328:Pfas'
ID422160
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
MMRRC Submission 042843-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5328 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68988592 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1160 (C1160S)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: C1160S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: C1160S

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146490
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152964
AA Change: C264S
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: C264S

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174986
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,837,694 V860E possibly damaging Het
Abcc6 T C 7: 45,992,311 D881G probably benign Het
Abcc9 A G 6: 142,682,059 V415A probably benign Het
Adgrb3 A C 1: 25,094,275 N1003K possibly damaging Het
Adora3 C T 3: 105,907,303 T123I probably benign Het
Amotl2 A C 9: 102,723,768 T345P probably benign Het
Arap3 C T 18: 37,991,687 E247K possibly damaging Het
Atp8b1 A T 18: 64,531,391 D1235E probably benign Het
Axl A T 7: 25,773,411 V400E probably damaging Het
Brd8 T A 18: 34,607,981 N431Y probably benign Het
Cadps A T 14: 12,457,790 N1025K probably benign Het
Cblc A T 7: 19,792,580 S195T possibly damaging Het
Chd2 C T 7: 73,463,681 A1184T possibly damaging Het
Chst10 G A 1: 38,895,962 probably benign Het
Col12a1 T C 9: 79,620,060 K2663E probably damaging Het
Cspg4 A T 9: 56,885,856 I292L probably benign Het
Cul1 T C 6: 47,508,317 V294A probably damaging Het
Cyp2d11 G A 15: 82,391,771 P203L probably benign Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eif3l A T 15: 79,093,361 K534* probably null Het
Enpep T C 3: 129,280,510 E796G probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam117a T A 11: 95,364,170 probably null Het
Fan1 A T 7: 64,354,469 Y750N probably damaging Het
Fat4 T A 3: 38,956,868 I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 D106Y probably damaging Het
Gak A C 5: 108,617,001 C145G possibly damaging Het
Galnt14 A T 17: 73,505,459 N406K possibly damaging Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm10837 G T 14: 122,490,778 R22L unknown Het
Gm19965 T A 1: 116,821,418 H276Q possibly damaging Het
Gm43517 T C 12: 49,391,156 probably benign Het
Gm9733 T C 3: 15,332,174 M17V unknown Het
Greb1l A T 18: 10,553,720 I1574F probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Heatr5b G A 17: 78,826,362 T266I possibly damaging Het
Hk3 T C 13: 55,013,493 I185V probably benign Het
Hnrnpr A G 4: 136,339,216 E302G probably benign Het
Itgal T C 7: 127,311,675 probably null Het
Itk A G 11: 46,331,876 S583P probably benign Het
Loxhd1 A T 18: 77,410,572 I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Man2a2 A T 7: 80,368,756 F118L probably benign Het
Mfsd5 T A 15: 102,281,012 V273E probably damaging Het
Nfe2l2 A G 2: 75,676,856 L300P probably damaging Het
Nt5c1a T G 4: 123,208,993 L122R possibly damaging Het
Nt5c3b A G 11: 100,440,241 F42S probably damaging Het
Olfr332 C A 11: 58,490,429 A109S possibly damaging Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Pabpc1 A T 15: 36,602,877 D204E probably benign Het
Panx2 A G 15: 89,068,095 N255S probably damaging Het
Pcnt A G 10: 76,411,719 L993P probably damaging Het
Plekhh3 T A 11: 101,167,658 probably benign Het
Plod3 T A 5: 136,989,683 N258K probably damaging Het
Prr14l T C 5: 32,830,021 Q710R probably benign Het
Rnf216 G T 5: 143,092,999 T65K possibly damaging Het
Samd9l T C 6: 3,376,739 E174G probably damaging Het
Sept12 T A 16: 4,993,993 M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,577,456 D22E probably benign Het
Skil A G 3: 31,117,569 K488R probably benign Het
Slamf6 T A 1: 171,938,095 I262K probably benign Het
Slc27a3 T C 3: 90,386,832 D470G probably damaging Het
Sorbs3 A T 14: 70,181,174 V680E probably damaging Het
Sox9 C T 11: 112,782,658 T25I probably benign Het
Srsf1 G T 11: 88,049,993 probably benign Het
Stard9 A C 2: 120,699,230 E1989D probably damaging Het
Thumpd2 T A 17: 81,044,162 I277F possibly damaging Het
Tinag C A 9: 77,005,631 G299* probably null Het
Tk2 A T 8: 104,229,299 probably null Het
Tmem44 A G 16: 30,540,891 S210P possibly damaging Het
Traf3ip1 C A 1: 91,520,069 P423T probably damaging Het
Trmt12 A G 15: 58,872,855 D34G probably damaging Het
Ttc39b A G 4: 83,261,941 Y72H probably damaging Het
Ttn G A 2: 76,878,411 probably benign Het
Ttyh2 T A 11: 114,710,068 I381N possibly damaging Het
Uaca A T 9: 60,870,532 N734Y probably benign Het
Usp34 T C 11: 23,464,616 I2853T probably benign Het
Usp34 G A 11: 23,488,659 G3407D probably benign Het
Vmn2r78 A G 7: 86,921,030 Y252C probably damaging Het
Wdr19 G A 5: 65,244,179 C979Y probably damaging Het
Wdr92 C A 11: 17,222,220 P103Q probably damaging Het
Yeats2 A T 16: 20,171,205 H277L probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfat C A 15: 68,179,828 G706C probably damaging Het
Zfp106 A T 2: 120,520,417 N1584K possibly damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
Predicted Primers PCR Primer
(F):5'- TTCCATCCCTCGGAGCATCAG -3'
(R):5'- AGGGCTGTCATGTCATTCCC -3'

Sequencing Primer
(F):5'- TCGGAGCATCAGGGCTG -3'
(R):5'- AGATGAGCGCCTCAGATTTC -3'
Posted On2016-08-04