Incidental Mutation 'R5340:Baz2a'
ID422288
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission 042919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5340 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128115042 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 535 (R535C)
Ref Sequence ENSEMBL: ENSMUSP00000151961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect probably damaging
Transcript: ENSMUST00000045621
AA Change: R535C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054
AA Change: R535C

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170054
AA Change: R536C

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054
AA Change: R536C

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217851
AA Change: R538C

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218772
Predicted Effect probably damaging
Transcript: ENSMUST00000219072
AA Change: R535C

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219980
Predicted Effect probably damaging
Transcript: ENSMUST00000220049
AA Change: R535C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik C T 13: 98,984,443 R25H possibly damaging Het
Aqp7 T C 4: 41,034,347 R271G probably benign Het
Atp4a A G 7: 30,720,806 I793V probably benign Het
BC034090 T C 1: 155,226,414 T35A possibly damaging Het
Bnip1 T C 17: 26,786,790 probably null Het
Ccdc136 A G 6: 29,411,860 S369G possibly damaging Het
Csrnp3 A G 2: 66,022,437 D391G probably benign Het
Ctbp2 G T 7: 133,013,963 H414Q probably benign Het
Dnah6 A G 6: 73,212,620 I15T probably benign Het
Dync2li1 A G 17: 84,649,702 probably null Het
Eri3 A T 4: 117,673,794 I329F probably damaging Het
Fam105a T C 15: 27,658,089 M282V possibly damaging Het
Flii T A 11: 60,717,268 I786F probably damaging Het
Fmo1 A T 1: 162,829,982 I530N probably benign Het
Gm10334 T C 6: 41,445,373 N33D probably benign Het
Gm28042 T C 2: 120,041,448 S960P probably benign Het
Gzmm C A 10: 79,695,073 F236L probably benign Het
Igkv4-55 A G 6: 69,607,505 V41A probably damaging Het
Ipo9 A G 1: 135,385,432 Y1020H probably benign Het
Masp1 T C 16: 23,458,108 Y549C probably damaging Het
Mblac1 A T 5: 138,194,578 S61C probably damaging Het
Mical1 T A 10: 41,483,431 probably null Het
Mroh9 C T 1: 163,080,587 probably benign Het
Mta2 T C 19: 8,942,356 M1T probably null Het
Neb A G 2: 52,223,048 Y4245H probably damaging Het
Olfr1263 T C 2: 90,015,362 V144A probably benign Het
Olfr736 T C 14: 50,393,220 F155L probably damaging Het
Pak2 G T 16: 32,034,946 probably null Het
Phc3 A T 3: 30,907,467 F939I probably damaging Het
Rogdi C A 16: 5,013,361 R14L probably benign Het
Ryr3 T C 2: 112,834,125 Y1627C probably damaging Het
Scrn3 A T 2: 73,335,810 K396* probably null Het
Sh3pxd2a T C 19: 47,268,231 N683D probably benign Het
Smtnl1 T A 2: 84,815,441 H362L probably damaging Het
Sned1 A G 1: 93,282,757 S927G probably benign Het
Tcaf1 A G 6: 42,678,989 V351A probably damaging Het
Tmem232 C T 17: 65,402,998 V432M possibly damaging Het
Ttll11 G T 2: 35,902,789 H347Q probably damaging Het
Vmn2r56 A C 7: 12,715,872 D146E probably damaging Het
Wwp1 A G 4: 19,638,773 probably null Het
Zcchc7 T A 4: 44,762,245 N124K probably benign Het
Zfp667 A G 7: 6,305,253 T307A possibly damaging Het
Zfp709 T A 8: 71,889,752 C342S probably damaging Het
Zfp940 A G 7: 29,844,841 V547A probably benign Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2059:Baz2a UTSW 10 128113578 missense probably damaging 0.98
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R2922:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R5891:Baz2a UTSW 10 128121322 missense probably damaging 1.00
R6088:Baz2a UTSW 10 128114642 small deletion probably benign
R6089:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R6894:Baz2a UTSW 10 128123581 missense possibly damaging 0.81
R7101:Baz2a UTSW 10 128121187 missense possibly damaging 0.66
R7178:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7179:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7202:Baz2a UTSW 10 128118559 missense possibly damaging 0.54
R7223:Baz2a UTSW 10 128112606 missense probably damaging 1.00
R7268:Baz2a UTSW 10 128124221 missense possibly damaging 0.66
R7426:Baz2a UTSW 10 128116078 missense probably damaging 1.00
R7464:Baz2a UTSW 10 128122073 missense possibly damaging 0.81
R7568:Baz2a UTSW 10 128125270 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAGAAGCACATGTCACATATGG -3'
(R):5'- GCTCCTTTGGATACTTGGGC -3'

Sequencing Primer
(F):5'- ACATATGGTGCCCATCCTTTTG -3'
(R):5'- AACCCTGCAGTTAGGAGCATTTG -3'
Posted On2016-08-04