Incidental Mutation 'R5341:Adcyap1r1'
List |< first << previous [record 66 of 1871] next >> last >|
ID422328
Institutional Source Beutler Lab
Gene Symbol Adcyap1r1
Ensembl Gene ENSMUSG00000029778
Gene Nameadenylate cyclase activating polypeptide 1 receptor 1
SynonymsPAC1R, PAC1, PACAP1-R, 2900024I10Rik
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55451978-55501451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 55478069 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 111 (F111L)
Ref Sequence ENSEMBL: ENSMUSP00000130742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070736] [ENSMUST00000070756] [ENSMUST00000165786] [ENSMUST00000165857] [ENSMUST00000166962] [ENSMUST00000167234] [ENSMUST00000172084]
Predicted Effect probably benign
Transcript: ENSMUST00000070736
SMART Domains Protein: ENSMUSP00000063784
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 3.6e-92 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070756
SMART Domains Protein: ENSMUSP00000066902
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 396 2.6e-93 PFAM
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165786
SMART Domains Protein: ENSMUSP00000130923
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 423 2.6e-92 PFAM
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165857
SMART Domains Protein: ENSMUSP00000129614
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 1.4e-94 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166962
AA Change: F111L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130742
Gene: ENSMUSG00000029778
AA Change: F111L

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:HRM 51 131 2.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167234
SMART Domains Protein: ENSMUSP00000126994
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 452 1.4e-91 PFAM
low complexity region 502 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172084
SMART Domains Protein: ENSMUSP00000127319
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 122 2.15e-27 SMART
Pfam:7tm_2 129 375 9e-94 PFAM
low complexity region 425 440 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted mutations affect contextual fear conditioning, elevated locomotor activity, anxiety-like behavior, susceptibility to endotoxic shock, circadian responses to a photic stimulus, and glucose tolerance. Some alleles affect female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Adcyap1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Adcyap1r1 APN 6 55472279 missense probably damaging 1.00
IGL00837:Adcyap1r1 APN 6 55461620 splice site probably benign
IGL02686:Adcyap1r1 APN 6 55481125 missense probably benign 0.37
IGL03229:Adcyap1r1 APN 6 55478123 missense probably damaging 1.00
R0360:Adcyap1r1 UTSW 6 55475523 intron probably benign
R0517:Adcyap1r1 UTSW 6 55491297 missense probably damaging 0.99
R1169:Adcyap1r1 UTSW 6 55494116 missense probably damaging 1.00
R1897:Adcyap1r1 UTSW 6 55479194 missense probably damaging 1.00
R2113:Adcyap1r1 UTSW 6 55481115 missense probably damaging 0.99
R4462:Adcyap1r1 UTSW 6 55480099 missense possibly damaging 0.90
R4871:Adcyap1r1 UTSW 6 55480093 missense probably null 0.09
R5146:Adcyap1r1 UTSW 6 55484972 missense probably benign 0.00
R6426:Adcyap1r1 UTSW 6 55494187 missense probably damaging 1.00
R6599:Adcyap1r1 UTSW 6 55479994 missense probably damaging 1.00
R6928:Adcyap1r1 UTSW 6 55479272 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGATCAGGTCGCTCATTCAC -3'
(R):5'- AGGCTCAGTATACAGCAGGCAG -3'

Sequencing Primer
(F):5'- GATCAGGTCGCTCATTCACCTACTC -3'
(R):5'- TATACAGCAGGCAGGCACTCATG -3'
Posted On2016-08-04