Incidental Mutation 'R5341:Dhx8'
ID422346
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 8
SynonymsRNA helicase, Ddx8, mDEAH6
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5341 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location101732919-101767358 bp(+) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) AGACCGGGACCGGGACCGGGACCGGGAC to AGACCGGGACCGGGACCGGGAC at 101738190 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
Predicted Effect probably benign
Transcript: ENSMUST00000039152
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125409
Predicted Effect probably benign
Transcript: ENSMUST00000129741
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156842
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101739807 missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101754826 missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101764027 critical splice donor site probably null
IGL02115:Dhx8 APN 11 101752388 missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101757606 missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101752004 splice site probably benign
IGL02697:Dhx8 APN 11 101754781 missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4342:Dhx8 UTSW 11 101738206 frame shift probably null
FR4449:Dhx8 UTSW 11 101738184 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738190 small deletion probably benign
FR4449:Dhx8 UTSW 11 101738194 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738206 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738207 small insertion probably benign
FR4589:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738179 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738182 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738189 small insertion probably benign
R0402:Dhx8 UTSW 11 101752397 missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101763928 missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101739700 splice site probably benign
R1497:Dhx8 UTSW 11 101735387 intron probably benign
R1576:Dhx8 UTSW 11 101752319 missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101766738 missense probably damaging 1.00
R1773:Dhx8 UTSW 11 101752363 missense possibly damaging 0.87
R1941:Dhx8 UTSW 11 101752198 critical splice donor site probably null
R1954:Dhx8 UTSW 11 101753279 missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101762245 missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101738409 missense probably benign 0.06
R2148:Dhx8 UTSW 11 101738377 nonsense probably null
R2206:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R2207:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R4667:Dhx8 UTSW 11 101738161 missense unknown
R4678:Dhx8 UTSW 11 101739808 missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101738170 nonsense probably null
R4943:Dhx8 UTSW 11 101737700 nonsense probably null
R5586:Dhx8 UTSW 11 101733036 unclassified probably benign
R5662:Dhx8 UTSW 11 101766758 missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101740751 missense probably damaging 1.00
R6082:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6415:Dhx8 UTSW 11 101737687 missense unknown
R6658:Dhx8 UTSW 11 101764922 missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101764792 missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101738421 nonsense probably null
R7011:Dhx8 UTSW 11 101741520 missense probably damaging 1.00
R7098:Dhx8 UTSW 11 101737768 critical splice donor site probably null
R7153:Dhx8 UTSW 11 101740175 intron probably null
R7284:Dhx8 UTSW 11 101754822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCATTACTGGCCTGTGG -3'
(R):5'- AGGGACTCTGACTTCTGCTC -3'

Sequencing Primer
(F):5'- GTCCAGTTAAGAAGTTAGAGGTTCC -3'
(R):5'- GGACTCTGACTTCTGCTCCTAGATC -3'
Posted On2016-08-04