Incidental Mutation 'R5342:Pde8b'
ID422403
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 042921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5342 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95041990 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 541 (T541A)
Ref Sequence ENSEMBL: ENSMUSP00000128987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000067082] [ENSMUST00000159608] [ENSMUST00000160957] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022192
AA Change: T549A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684
AA Change: T549A

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067082
AA Change: T576A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: T576A

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159608
AA Change: T549A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125191
Gene: ENSMUSG00000021684
AA Change: T549A

DomainStartEndE-ValueType
Pfam:PDE8 1 52 1.7e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.1e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 666 9.37e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160412
Predicted Effect probably benign
Transcript: ENSMUST00000160957
SMART Domains Protein: ENSMUSP00000125115
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Response_reg 30 148 5.7e-16 PFAM
Blast:PAS 165 188 1e-7 BLAST
Blast:HDc 266 327 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000162153
AA Change: T491A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: T491A

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162292
AA Change: T499A

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684
AA Change: T499A

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162412
AA Change: T441A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684
AA Change: T441A

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162882
Predicted Effect probably damaging
Transcript: ENSMUST00000172104
AA Change: T541A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: T541A

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,226,781 Y392* probably null Het
Arap1 G A 7: 101,404,960 E1330K probably benign Het
Atg2b G T 12: 105,658,916 D600E possibly damaging Het
Atp1b2 C T 11: 69,602,828 V142I probably damaging Het
AW551984 A T 9: 39,594,551 M450K probably damaging Het
BC067074 T C 13: 113,366,269 probably null Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Ccnt2 T C 1: 127,791,733 silent Het
Cdca7l A G 12: 117,877,033 Y430C probably damaging Het
Ces4a A G 8: 105,146,143 T343A probably benign Het
Clec2g C T 6: 128,948,751 A41V probably benign Het
Crybg3 A T 16: 59,522,149 Y2708N probably damaging Het
Dmxl1 A T 18: 49,951,235 E2758V probably damaging Het
Dusp27 T C 1: 166,110,250 E80G probably benign Het
Eci2 C T 13: 34,978,724 E283K probably benign Het
Edrf1 T A 7: 133,651,910 probably null Het
Eif3b T C 5: 140,425,280 L162P probably damaging Het
Ercc3 A G 18: 32,245,595 I210V probably benign Het
Exoc1 A G 5: 76,567,014 N739S probably damaging Het
Gm7334 A G 17: 50,698,754 K23E probably benign Het
Gm7356 T G 17: 14,001,098 D223A possibly damaging Het
Klhl26 A G 8: 70,455,565 L47P probably damaging Het
Klhl42 C T 6: 147,092,286 T252I possibly damaging Het
Morc1 G T 16: 48,618,509 G756W probably damaging Het
Mroh2b G T 15: 4,914,133 E384* probably null Het
Nol10 G A 12: 17,369,620 probably null Het
Nxpe5 T C 5: 138,239,241 L9P probably damaging Het
Olfr457 A G 6: 42,471,902 I92T probably damaging Het
Olfr617 C T 7: 103,584,828 R269C probably benign Het
Olfr857 A G 9: 19,713,037 D70G probably damaging Het
Pak2 T C 16: 32,044,488 E94G probably damaging Het
Pcdha7 A G 18: 36,974,671 K250E possibly damaging Het
Peg3 A T 7: 6,709,970 I751N probably damaging Het
Prpsap2 T C 11: 61,731,570 D269G probably damaging Het
Raver2 C A 4: 101,102,692 T123K possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Scn2b A G 9: 45,125,518 Y108C probably damaging Het
Sdr16c6 T C 4: 4,069,923 E139G probably damaging Het
Sgpp2 A G 1: 78,360,188 I68V probably benign Het
Sorbs2 T A 8: 45,796,013 I687N probably damaging Het
Sorcs3 G A 19: 48,796,472 probably null Het
Stk16 T A 1: 75,212,965 C174S probably benign Het
Ttll9 C A 2: 152,991,652 N198K possibly damaging Het
Unc13c A T 9: 73,930,823 D915E probably benign Het
Unc5b T A 10: 60,778,267 K268* probably null Het
Vim T A 2: 13,580,013 probably null Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zfp160 T G 17: 21,020,733 M21R possibly damaging Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1436:Pde8b UTSW 13 95026170 missense probably benign 0.00
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R1879:Pde8b UTSW 13 95085215 missense possibly damaging 0.95
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R2892:Pde8b UTSW 13 95034259 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4623:Pde8b UTSW 13 95041939 missense possibly damaging 0.69
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5134:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5314:Pde8b UTSW 13 95086853 missense possibly damaging 0.89
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5806:Pde8b UTSW 13 95042040 missense probably damaging 1.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
R7275:Pde8b UTSW 13 95042934 missense probably damaging 1.00
R7483:Pde8b UTSW 13 95027743 missense probably damaging 1.00
R7553:Pde8b UTSW 13 95086750 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GAGTTCTTGAATCTCCACCCTAG -3'
(R):5'- CTAGTTGCAAAGTGGGGCTG -3'

Sequencing Primer
(F):5'- TCTTGAATCTCCACCCTAGCACAC -3'
(R):5'- CTGGTTAAGCAGTACCAGTGTTTC -3'
Posted On2016-08-04