Mutagenetix > Incidental Mutation

Incidental Mutation 'R5342:Sorcs3'

422418

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

042921-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5342 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48194464-48793944 bp(+) (GRCm39)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 48784911 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

probably null
Transcript: ENSMUST00000078880

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adrb3	A	C	8: 27,716,809 (GRCm39)	Y392*	probably null	Het
Arap1	G	A	7: 101,054,167 (GRCm39)	E1330K	probably benign	Het
Atg2b	G	T	12: 105,625,175 (GRCm39)	D600E	possibly damaging	Het
Atp1b2	C	T	11: 69,493,654 (GRCm39)	V142I	probably damaging	Het
AW551984	A	T	9: 39,505,847 (GRCm39)	M450K	probably damaging	Het
Bcar3	A	G	3: 122,220,298 (GRCm39)	D65G	probably damaging	Het
Ccnt2	T	C	1: 127,719,470 (GRCm39)		silent	Het
Cdca7l	A	G	12: 117,840,768 (GRCm39)	Y430C	probably damaging	Het
Ces4a	A	G	8: 105,872,775 (GRCm39)	T343A	probably benign	Het
Clec2g	C	T	6: 128,925,714 (GRCm39)	A41V	probably benign	Het
Crybg3	A	T	16: 59,342,512 (GRCm39)	Y2708N	probably damaging	Het
Cspg4b	T	C	13: 113,502,803 (GRCm39)		probably null	Het
Dmxl1	A	T	18: 50,084,302 (GRCm39)	E2758V	probably damaging	Het
Eci2	C	T	13: 35,162,707 (GRCm39)	E283K	probably benign	Het
Edrf1	T	A	7: 133,253,639 (GRCm39)		probably null	Het
Eif3b	T	C	5: 140,411,035 (GRCm39)	L162P	probably damaging	Het
Ercc3	A	G	18: 32,378,648 (GRCm39)	I210V	probably benign	Het
Exoc1	A	G	5: 76,714,861 (GRCm39)	N739S	probably damaging	Het
Gm7334	A	G	17: 51,005,782 (GRCm39)	K23E	probably benign	Het
Gm7356	T	G	17: 14,221,360 (GRCm39)	D223A	possibly damaging	Het
Klhl26	A	G	8: 70,908,215 (GRCm39)	L47P	probably damaging	Het
Klhl42	C	T	6: 146,993,784 (GRCm39)	T252I	possibly damaging	Het
Morc1	G	T	16: 48,438,872 (GRCm39)	G756W	probably damaging	Het
Mroh2b	G	T	15: 4,943,615 (GRCm39)	E384*	probably null	Het
Nol10	G	A	12: 17,419,621 (GRCm39)		probably null	Het
Nxpe5	T	C	5: 138,237,503 (GRCm39)	L9P	probably damaging	Het
Or2r3	A	G	6: 42,448,836 (GRCm39)	I92T	probably damaging	Het
Or52z12	C	T	7: 103,234,035 (GRCm39)	R269C	probably benign	Het
Or7e166	A	G	9: 19,624,333 (GRCm39)	D70G	probably damaging	Het
Pak2	T	C	16: 31,863,306 (GRCm39)	E94G	probably damaging	Het
Pcdha7	A	G	18: 37,107,724 (GRCm39)	K250E	possibly damaging	Het
Pde8b	T	C	13: 95,178,498 (GRCm39)	T541A	probably damaging	Het
Peg3	A	T	7: 6,712,969 (GRCm39)	I751N	probably damaging	Het
Prpsap2	T	C	11: 61,622,396 (GRCm39)	D269G	probably damaging	Het
Raver2	C	A	4: 100,959,889 (GRCm39)	T123K	possibly damaging	Het
Rpgrip1	G	A	14: 52,382,666 (GRCm39)	D600N	possibly damaging	Het
Scn2b	A	G	9: 45,036,816 (GRCm39)	Y108C	probably damaging	Het
Sdr16c6	T	C	4: 4,069,923 (GRCm39)	E139G	probably damaging	Het
Sgpp2	A	G	1: 78,336,825 (GRCm39)	I68V	probably benign	Het
Sorbs2	T	A	8: 46,249,050 (GRCm39)	I687N	probably damaging	Het
Stk16	T	A	1: 75,189,609 (GRCm39)	C174S	probably benign	Het
Styxl2	T	C	1: 165,937,819 (GRCm39)	E80G	probably benign	Het
Ttll9	C	A	2: 152,833,572 (GRCm39)	N198K	possibly damaging	Het
Unc13c	A	T	9: 73,838,105 (GRCm39)	D915E	probably benign	Het
Unc5b	T	A	10: 60,614,046 (GRCm39)	K268*	probably null	Het
Vim	T	A	2: 13,584,824 (GRCm39)		probably null	Het
Xirp2	T	A	2: 67,343,805 (GRCm39)	N2015K	probably damaging	Het
Zfp160	T	G	17: 21,240,995 (GRCm39)	M21R	possibly damaging	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48,672,097 (GRCm39)	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48,736,758 (GRCm39)	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48,592,303 (GRCm39)	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48,755,542 (GRCm39)	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48,784,814 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48,778,570 (GRCm39)	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48,782,607 (GRCm39)	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48,523,970 (GRCm39)	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48,642,511 (GRCm39)	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48,692,809 (GRCm39)	splice site	probably benign
IGL02830:Sorcs3	APN	19	48,711,441 (GRCm39)	splice site	probably null
IGL02943:Sorcs3	APN	19	48,748,377 (GRCm39)	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48,592,333 (GRCm39)	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48,642,483 (GRCm39)	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48,736,758 (GRCm39)	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48,785,956 (GRCm39)	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48,791,137 (GRCm39)	nonsense	probably null
R0646:Sorcs3	UTSW	19	48,194,734 (GRCm39)	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48,475,845 (GRCm39)	missense	probably benign
R0792:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48,682,433 (GRCm39)	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48,475,833 (GRCm39)	missense	probably benign
R1253:Sorcs3	UTSW	19	48,195,175 (GRCm39)	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48,682,440 (GRCm39)	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48,752,620 (GRCm39)	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48,736,798 (GRCm39)	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48,592,314 (GRCm39)	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48,782,713 (GRCm39)	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R3789:Sorcs3	UTSW	19	48,387,150 (GRCm39)	missense	possibly damaging	0.46
R3818:Sorcs3	UTSW	19	48,592,343 (GRCm39)	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48,711,395 (GRCm39)	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48,737,812 (GRCm39)	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48,682,353 (GRCm39)	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48,672,036 (GRCm39)	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48,782,602 (GRCm39)	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48,752,587 (GRCm39)	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48,748,390 (GRCm39)	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48,748,284 (GRCm39)	critical splice acceptor site	probably null
R5848:Sorcs3	UTSW	19	48,776,950 (GRCm39)	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48,737,835 (GRCm39)	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48,784,889 (GRCm39)	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48,387,136 (GRCm39)	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48,748,296 (GRCm39)	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48,778,605 (GRCm39)	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48,791,198 (GRCm39)	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48,752,746 (GRCm39)	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48,776,944 (GRCm39)	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48,702,010 (GRCm39)	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48,682,263 (GRCm39)	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48,737,782 (GRCm39)	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48,694,402 (GRCm39)	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48,760,705 (GRCm39)	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48,692,808 (GRCm39)	splice site	probably null
R8433:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48,784,908 (GRCm39)	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48,737,810 (GRCm39)	nonsense	probably null
R9051:Sorcs3	UTSW	19	48,194,809 (GRCm39)	missense	probably benign
R9119:Sorcs3	UTSW	19	48,642,433 (GRCm39)	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48,784,811 (GRCm39)	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48,785,950 (GRCm39)	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48,711,363 (GRCm39)	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48,760,728 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48,634,243 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48,692,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACCAAGTTGATGTCCCTATCC -3'
(R):5'- CTGTAGTACCTCCCGAATACCC -3'

Sequencing Primer
(F):5'- TGATGTCCCTATCCCATGAATGAAC -3'
(R):5'- CTCAGAAACACAAGGCTAACTTTTTC -3'

Posted On

2016-08-04