Incidental Mutation 'R5343:2310039H08Rik'
List |< first << previous [record 78 of 18487] next >> last >|
ID422463
Institutional Source Beutler Lab
Gene Symbol 2310039H08Rik
Ensembl Gene ENSMUSG00000062619
Gene NameRIKEN cDNA 2310039H08 gene
Synonyms
MMRRC Submission 042922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5343 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46772635-46773407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46773036 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 75 (A75E)
Ref Sequence ENSEMBL: ENSMUSP00000071378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071430] [ENSMUST00000078286]
Predicted Effect probably damaging
Transcript: ENSMUST00000071430
AA Change: A75E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000078286
SMART Domains Protein: ENSMUSP00000092888
Gene: ENSMUSG00000063888

DomainStartEndE-ValueType
Pfam:Ribosomal_L30_N 16 85 7.2e-18 PFAM
Pfam:Ribosomal_L30 88 138 3.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,225,442 H237Q probably benign Het
Adck5 G A 15: 76,595,580 R560H probably damaging Het
Ahctf1 A T 1: 179,770,634 Y964* probably null Het
Alg8 T C 7: 97,386,919 I339T possibly damaging Het
Alox5 T C 6: 116,413,507 D503G possibly damaging Het
Camk4 A G 18: 33,078,069 T76A probably damaging Het
Cdh3 T C 8: 106,552,936 V728A probably benign Het
Chd4 T A 6: 125,120,363 N1326K probably damaging Het
Cnn1 A T 9: 22,105,410 Y48F probably benign Het
Dnah6 T A 6: 73,212,616 E16D probably benign Het
Ezh2 A G 6: 47,576,615 L56S probably damaging Het
F13b T C 1: 139,510,544 V299A possibly damaging Het
Hydin T C 8: 110,485,419 S1279P probably benign Het
Ift172 T C 5: 31,263,812 M981V probably benign Het
Lpl T A 8: 68,895,737 V206E probably damaging Het
Mre11a A G 9: 14,811,834 D368G probably damaging Het
Mreg G A 1: 72,160,958 P191L probably damaging Het
Mtif2 G T 11: 29,536,964 A134S probably damaging Het
Mxd4 T C 5: 34,177,730 S114G probably benign Het
Myo1b T C 1: 51,778,537 Q522R probably benign Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Ninl T C 2: 150,971,190 E182G probably benign Het
Notch3 T C 17: 32,143,283 N1456S probably benign Het
Npr1 G T 3: 90,458,208 N648K possibly damaging Het
Oas3 A G 5: 120,756,238 S1016P possibly damaging Het
Olfr1499 T C 19: 13,814,960 N210S probably damaging Het
Olfr518 C T 7: 108,880,998 V203M possibly damaging Het
Palld A G 8: 61,549,815 probably benign Het
Patj T G 4: 98,676,193 I1021S probably damaging Het
Pfpl T A 19: 12,428,688 L101Q probably damaging Het
Pilrb2 T A 5: 137,870,966 E124V possibly damaging Het
Pomk A G 8: 25,983,016 F303S probably benign Het
Rap1gap2 A T 11: 74,441,785 S65T probably damaging Het
Sema3a G A 5: 13,473,406 C114Y probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Spry4 A T 18: 38,589,975 V245E probably damaging Het
Srrt T C 5: 137,297,165 Y271C probably damaging Het
Tas2r136 A G 6: 132,778,080 V28A probably benign Het
Tenm2 A G 11: 36,069,503 V998A probably benign Het
Trim37 A G 11: 87,137,603 E46G probably damaging Het
Ubiad1 A G 4: 148,436,435 V244A possibly damaging Het
Other mutations in 2310039H08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3086:2310039H08Rik UTSW 17 46772955 missense probably damaging 1.00
R4684:2310039H08Rik UTSW 17 46772946 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTGCTTACAGCCGGATCC -3'
(R):5'- ACTCAAGTTTGTGTAGGACCC -3'

Sequencing Primer
(F):5'- CTGGTGGCAGGACATGGAC -3'
(R):5'- TTGTGTAGGACCCAGTCATGCC -3'
Posted On2016-08-04