Incidental Mutation 'R5344:Reg3b'
ID422492
Institutional Source Beutler Lab
Gene Symbol Reg3b
Ensembl Gene ENSMUSG00000071356
Gene Nameregenerating islet-derived 3 beta
SynonymsPap, PAP1, REG-III, RegIII (beta)
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location78370657-78373466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78372860 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 128 (M128V)
Ref Sequence ENSEMBL: ENSMUSP00000145280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089667] [ENSMUST00000096904] [ENSMUST00000167492] [ENSMUST00000203266] [ENSMUST00000204873] [ENSMUST00000205240]
Predicted Effect probably benign
Transcript: ENSMUST00000089667
SMART Domains Protein: ENSMUSP00000087096
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096904
AA Change: M128V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094667
Gene: ENSMUSG00000071356
AA Change: M128V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167492
SMART Domains Protein: ENSMUSP00000132220
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203266
AA Change: M128V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145528
Gene: ENSMUSG00000071356
AA Change: M128V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 143 5e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204760
Predicted Effect probably benign
Transcript: ENSMUST00000204873
AA Change: M128V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145280
Gene: ENSMUSG00000071356
AA Change: M128V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 140 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205240
SMART Domains Protein: ENSMUSP00000144715
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It has similarity to the C-type lectin superfamily. The enhanced expression of this gene is observed during pancreatic inflammation and liver carcinogenesis. The mature protein also functions as an antimicrobial protein with antibacterial activity. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Nov 2014]
PHENOTYPE: Male homozygous mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Reg3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Reg3b APN 6 78372200 nonsense probably null
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0413:Reg3b UTSW 6 78371841 missense probably damaging 1.00
R1321:Reg3b UTSW 6 78372953 unclassified probably null
R1794:Reg3b UTSW 6 78372214 unclassified probably null
R1960:Reg3b UTSW 6 78371814 missense probably damaging 0.98
R2513:Reg3b UTSW 6 78371819 missense probably benign 0.00
R3877:Reg3b UTSW 6 78371233 missense possibly damaging 0.65
R4033:Reg3b UTSW 6 78373209 missense possibly damaging 0.71
R4874:Reg3b UTSW 6 78372826 missense possibly damaging 0.53
R5118:Reg3b UTSW 6 78372128 missense probably damaging 1.00
R5301:Reg3b UTSW 6 78371260 missense probably damaging 0.96
R5408:Reg3b UTSW 6 78373232 missense probably benign
R5824:Reg3b UTSW 6 78372121 missense possibly damaging 0.83
R6643:Reg3b UTSW 6 78372922 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGTGTGCTCTTGAAAGCTGC -3'
(R):5'- CACCAGTGTTAGAATCTAGGGG -3'

Sequencing Primer
(F):5'- GCATATGATCACCCAAGTTCTGG -3'
(R):5'- TCTAGGGGAAGGAGACACCC -3'
Posted On2016-08-04