Incidental Mutation 'R5344:Med21'
ID422496
Institutional Source Beutler Lab
Gene Symbol Med21
Ensembl Gene ENSMUSG00000030291
Gene Namemediator complex subunit 21
Synonyms0610007L03Rik, Srb7, D6Ertd782e, Surb7
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146642547-146650732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146649185 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 65 (T65A)
Ref Sequence ENSEMBL: ENSMUSP00000145512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032429] [ENSMUST00000111650] [ENSMUST00000204040]
Predicted Effect probably benign
Transcript: ENSMUST00000032429
AA Change: T65A

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032429
Gene: ENSMUSG00000030291
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Med21 1 127 1.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075077
Predicted Effect probably benign
Transcript: ENSMUST00000111650
AA Change: T65A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107277
Gene: ENSMUSG00000030291
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Med21 1 90 8.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134387
Predicted Effect probably benign
Transcript: ENSMUST00000204040
AA Change: T65A

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145512
Gene: ENSMUSG00000030291
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Med21 1 127 1.1e-29 PFAM
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Med21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02647:Med21 APN 6 146649233 missense probably benign 0.44
IGL03369:Med21 APN 6 146642645 missense probably benign 0.21
R0049:Med21 UTSW 6 146650234 missense probably damaging 0.99
R0049:Med21 UTSW 6 146650234 missense probably damaging 0.99
R0967:Med21 UTSW 6 146650199 missense probably benign 0.02
R2106:Med21 UTSW 6 146649212 missense probably damaging 1.00
R4403:Med21 UTSW 6 146649182 nonsense probably null
R4675:Med21 UTSW 6 146650193 missense probably damaging 0.97
R4747:Med21 UTSW 6 146649202 missense possibly damaging 0.58
R4749:Med21 UTSW 6 146650101 splice site probably null
R4855:Med21 UTSW 6 146648192 missense probably damaging 1.00
R5117:Med21 UTSW 6 146647283 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGAAAACATCTCATCTATGGATTCC -3'
(R):5'- GACAGAGTATTGACCTAGTATGTGAG -3'

Sequencing Primer
(F):5'- TACAGATGGTTGTGAGCCACC -3'
(R):5'- GTATGTGAGATCTTAGATTTGACCAC -3'
Posted On2016-08-04