Incidental Mutation 'R5344:Lrrc3b'
ID422523
Institutional Source Beutler Lab
Gene Symbol Lrrc3b
Ensembl Gene ENSMUSG00000045201
Gene Nameleucine rich repeat containing 3B
SynonymsLRP15
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location15357515-15438987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15358591 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 5 (D5G)
Ref Sequence ENSEMBL: ENSMUSP00000153616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]
Predicted Effect probably damaging
Transcript: ENSMUST00000055211
AA Change: D5G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: D5G

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163937
AA Change: D5G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: D5G

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223700
AA Change: D5G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Lrrc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lrrc3b APN 14 15358098 missense probably benign 0.00
IGL03141:Lrrc3b APN 14 15358390 missense probably damaging 1.00
Klutz UTSW 14 15357946 missense probably damaging 1.00
PIT4810001:Lrrc3b UTSW 14 15358273 missense probably benign 0.17
R0371:Lrrc3b UTSW 14 15358560 nonsense probably null
R1750:Lrrc3b UTSW 14 15358601 missense probably benign 0.00
R2280:Lrrc3b UTSW 14 15358076 missense probably damaging 0.99
R4663:Lrrc3b UTSW 14 15358220 missense probably benign 0.01
R4929:Lrrc3b UTSW 14 15357888 missense probably damaging 1.00
R6537:Lrrc3b UTSW 14 15357946 missense probably damaging 1.00
R7301:Lrrc3b UTSW 14 15357934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAGATCTCTGGGTATTTCC -3'
(R):5'- CCATGCATGTCTCCTCACAG -3'

Sequencing Primer
(F):5'- CCTTGAGATTTGCATTGCTACAG -3'
(R):5'- TGTCTCCTCACAGAAAAGCTAATTGC -3'
Posted On2016-08-04