Incidental Mutation 'R5345:Kif5c'
ID422542
Institutional Source Beutler Lab
Gene Symbol Kif5c
Ensembl Gene ENSMUSG00000026764
Gene Namekinesin family member 5C
SynonymsKhc
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location49619298-49774778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49723066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000117370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028102] [ENSMUST00000146247]
Predicted Effect probably benign
Transcript: ENSMUST00000028102
AA Change: T403A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028102
Gene: ENSMUSG00000026764
AA Change: T403A

DomainStartEndE-ValueType
KISc 6 335 2.8e-173 SMART
low complexity region 340 357 N/A INTRINSIC
coiled coil region 407 541 N/A INTRINSIC
coiled coil region 592 803 N/A INTRINSIC
coiled coil region 826 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138834
Predicted Effect probably benign
Transcript: ENSMUST00000146247
AA Change: T139A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117370
Gene: ENSMUSG00000026764
AA Change: T139A

DomainStartEndE-ValueType
Pfam:Kinesin 1 63 2.1e-23 PFAM
coiled coil region 67 109 N/A INTRINSIC
coiled coil region 143 243 N/A INTRINSIC
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin heavy chain subunit involved in the transport of cargo within the central nervous system. The encoded protein, which acts as a tetramer by associating with another heavy chain and two light chains, interacts with protein kinase CK2. Mutations in this gene have been associated with complex cortical dysplasia with other brain malformations-2. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homezygous for disruptions in this gene are viable, fertile, and of normal size. The brain is normal but slightly reduced in size with decreased numbers of motor neurons an somewhat more sensory nerves than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Kif5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Kif5c APN 2 49694816 missense possibly damaging 0.81
IGL01432:Kif5c APN 2 49701077 missense probably damaging 1.00
IGL01459:Kif5c APN 2 49735557 missense probably benign 0.36
IGL02127:Kif5c APN 2 49701110 splice site probably null
IGL03088:Kif5c APN 2 49744443 missense probably benign 0.01
IGL03379:Kif5c APN 2 49701092 missense probably damaging 0.97
IGL02988:Kif5c UTSW 2 49619717 missense probably damaging 0.97
PIT4131001:Kif5c UTSW 2 49694032 missense probably damaging 0.99
PIT4469001:Kif5c UTSW 2 49741348 missense probably benign 0.00
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0116:Kif5c UTSW 2 49752239 splice site probably benign
R0550:Kif5c UTSW 2 49758912 missense possibly damaging 0.53
R0760:Kif5c UTSW 2 49688753 missense probably damaging 1.00
R0967:Kif5c UTSW 2 49698116 unclassified probably benign
R1015:Kif5c UTSW 2 49744365 missense probably benign 0.13
R1758:Kif5c UTSW 2 49723133 missense probably benign 0.00
R1786:Kif5c UTSW 2 49758805 splice site probably benign
R1828:Kif5c UTSW 2 49680240 critical splice donor site probably null
R2130:Kif5c UTSW 2 49758805 splice site probably benign
R2132:Kif5c UTSW 2 49758805 splice site probably benign
R2237:Kif5c UTSW 2 49694008 missense probably benign 0.35
R3970:Kif5c UTSW 2 49688744 missense probably damaging 1.00
R4439:Kif5c UTSW 2 49688725 missense possibly damaging 0.90
R5260:Kif5c UTSW 2 49735590 missense probably damaging 0.99
R5318:Kif5c UTSW 2 49671828 missense probably benign
R5490:Kif5c UTSW 2 49758858 missense probably benign
R5496:Kif5c UTSW 2 49730190 missense possibly damaging 0.69
R5567:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R5570:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R6019:Kif5c UTSW 2 49735509 missense probably benign 0.09
R6688:Kif5c UTSW 2 49688737 missense probably benign 0.06
R7006:Kif5c UTSW 2 49735514 missense probably damaging 0.97
R7009:Kif5c UTSW 2 49757429 missense probably benign
R7081:Kif5c UTSW 2 49741361 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGCGGCAATTCTTAGAGC -3'
(R):5'- TTCAAATGGCAGCTCTCCGG -3'

Sequencing Primer
(F):5'- GAGCGGCAATTCTTAGAGCTCTTC -3'
(R):5'- AACATAATGCTCAGGTCTGTGCC -3'
Posted On2016-08-04