Incidental Mutation 'R5345:Gm11487'
ID422547
Institutional Source Beutler Lab
Gene Symbol Gm11487
Ensembl Gene ENSMUSG00000066137
Gene Namepredicted gene 11487
Synonyms
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location73401032-73405072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73401277 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 77 (W77R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084480
AA Change: W321R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081520
Gene: ENSMUSG00000066137
AA Change: W321R

DomainStartEndE-ValueType
low complexity region 69 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147434
AA Change: W77R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene belongs to a family of related genes tandemly arranged in two clusters on chromosome 4. This family, which appears to be mouse-specific and composed of multiple highly similar members, is supported by limited transcript data. Members of the family maintain an intact open reading frame although the encoded protein has no known function. This gene is inferred from alignment of paralogous transcripts. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Gm11487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Gm11487 APN 4 73403643 missense probably benign 0.01
IGL03275:Gm11487 APN 4 73403416 missense possibly damaging 0.80
R1066:Gm11487 UTSW 4 73401829 missense possibly damaging 0.46
R1274:Gm11487 UTSW 4 73403076 missense probably damaging 0.97
R1742:Gm11487 UTSW 4 73401210 missense probably damaging 1.00
R1863:Gm11487 UTSW 4 73401800 nonsense probably null
R1903:Gm11487 UTSW 4 73403438 missense probably damaging 0.98
R2027:Gm11487 UTSW 4 73403058 missense possibly damaging 0.46
R4011:Gm11487 UTSW 4 73401810 missense probably damaging 0.97
R4801:Gm11487 UTSW 4 73401267 nonsense probably null
R4802:Gm11487 UTSW 4 73401267 nonsense probably null
R5213:Gm11487 UTSW 4 73401334 missense probably damaging 0.96
R5334:Gm11487 UTSW 4 73403517 missense probably benign 0.31
R6093:Gm11487 UTSW 4 73402021 missense probably benign 0.05
R6786:Gm11487 UTSW 4 73403606 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATCCATACAGTGCTGGAAGATTC -3'
(R):5'- GGCAATTTCTTAGAGTGACTCAGG -3'

Sequencing Primer
(F):5'- CATACAGTGCTGGAAGATTCTTAGTG -3'
(R):5'- CTTCTCAGGTGCTCTGTATAATTG -3'
Posted On2016-08-04