Incidental Mutation 'R5345:Coq8b'
ID422556
Institutional Source Beutler Lab
Gene Symbol Coq8b
Ensembl Gene ENSMUSG00000003762
Gene Namecoenzyme Q8B
Synonyms0610012P18Rik, Adck4
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27233023-27257950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27250348 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 320 (T320A)
Ref Sequence ENSEMBL: ENSMUSP00000104015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003860] [ENSMUST00000108378] [ENSMUST00000128090]
Predicted Effect probably benign
Transcript: ENSMUST00000003860
AA Change: T320A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003860
Gene: ENSMUSG00000003762
AA Change: T320A

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.9e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108378
AA Change: T320A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104015
Gene: ENSMUSG00000003762
AA Change: T320A

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.4e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123012
Predicted Effect probably benign
Transcript: ENSMUST00000128090
SMART Domains Protein: ENSMUSP00000123309
Gene: ENSMUSG00000003762

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 304 3.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152342
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two copies of a domain found in protein kinases. The encoded protein has a complete protein kinase catalytic domain, and a truncated domain that contains only the active and binding sites of the protein kinase domain, however, it is not known whether the protein has any kinase activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Coq8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Coq8b APN 7 27257477 missense probably benign
IGL01116:Coq8b APN 7 27239857 missense possibly damaging 0.82
IGL01123:Coq8b APN 7 27240084 missense probably damaging 1.00
IGL02949:Coq8b APN 7 27256613 missense possibly damaging 0.70
R0067:Coq8b UTSW 7 27233481 missense possibly damaging 0.87
R0690:Coq8b UTSW 7 27242249 missense probably benign 0.15
R1307:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1551:Coq8b UTSW 7 27257482 missense probably damaging 1.00
R1682:Coq8b UTSW 7 27240124 missense probably benign 0.00
R1895:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R1945:Coq8b UTSW 7 27233980 small insertion probably benign
R1945:Coq8b UTSW 7 27233981 small insertion probably benign
R1946:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R2069:Coq8b UTSW 7 27257377 missense probably damaging 1.00
R3758:Coq8b UTSW 7 27242227 nonsense probably null
R4545:Coq8b UTSW 7 27233505 missense probably benign 0.45
R4838:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R5181:Coq8b UTSW 7 27252322 missense possibly damaging 0.65
R5806:Coq8b UTSW 7 27250625 nonsense probably null
R5943:Coq8b UTSW 7 27234003 missense probably damaging 1.00
R6005:Coq8b UTSW 7 27257325 nonsense probably null
R7028:Coq8b UTSW 7 27239868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATTGGCTGTCACCCAAG -3'
(R):5'- CAACCTCAGGAGCTGAAAGC -3'

Sequencing Primer
(F):5'- TGTCACCCAAGGCAGCC -3'
(R):5'- TCTGGAGGAACAAGAAGACATGCC -3'
Posted On2016-08-04