Incidental Mutation 'R5345:P2rx1'
ID422571
Institutional Source Beutler Lab
Gene Symbol P2rx1
Ensembl Gene ENSMUSG00000020787
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 1
SynonymsP2X1 receptor, P2x, Pdcd3, RP-2
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72999103-73015200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73009230 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000090614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021141] [ENSMUST00000092938]
Predicted Effect probably damaging
Transcript: ENSMUST00000021141
AA Change: T158A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021141
Gene: ENSMUSG00000020787
AA Change: T158A

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 376 1.2e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092938
AA Change: T158A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090614
Gene: ENSMUSG00000020787
AA Change: T158A

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 182 1.1e-71 PFAM
Pfam:P2X_receptor 171 355 2.1e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148964
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit low male fertility due to impaired vas deferens contraction and reduced numbers of ejaculated sperm. Mutants also show mild hypertension and reduced susceptibility to experimental thromboembolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in P2rx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:P2rx1 APN 11 73013000 critical splice donor site probably null
IGL01109:P2rx1 APN 11 73008215 missense probably damaging 0.99
IGL02466:P2rx1 APN 11 73009584 critical splice acceptor site probably null
IGL02524:P2rx1 APN 11 73009648 missense probably damaging 1.00
IGL02536:P2rx1 APN 11 73012474 missense probably damaging 1.00
PIT4382001:P2rx1 UTSW 11 73009200 missense probably benign 0.09
R0479:P2rx1 UTSW 11 73012961 missense probably damaging 1.00
R1238:P2rx1 UTSW 11 73012958 missense probably damaging 1.00
R2156:P2rx1 UTSW 11 73014113 missense probably benign 0.15
R4016:P2rx1 UTSW 11 73009973 missense probably damaging 1.00
R5440:P2rx1 UTSW 11 73008503 missense probably benign
R6172:P2rx1 UTSW 11 73010030 missense probably damaging 0.99
R6285:P2rx1 UTSW 11 73008148 missense probably benign 0.22
R6348:P2rx1 UTSW 11 72999322 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACTCCAGGAAAAGCAG -3'
(R):5'- GACTCTTGGGCCACATGGATAG -3'

Sequencing Primer
(F):5'- TAAGAGCAGCCCCTTCCTG -3'
(R):5'- GCCACATGGATAGGCTGAG -3'
Posted On2016-08-04